ID: 983138373

View in Genome Browser
Species Human (GRCh38)
Location 4:164115235-164115257
Sequence ATAATCAGTCATGAGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983138372_983138373 -3 Left 983138372 4:164115215-164115237 CCATTACTTAAGAATGAGCAATA 0: 1
1: 0
2: 0
3: 13
4: 186
Right 983138373 4:164115235-164115257 ATAATCAGTCATGAGCAATGAGG 0: 1
1: 0
2: 0
3: 10
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983138373 Original CRISPR ATAATCAGTCATGAGCAATG AGG Intronic