ID: 983138373 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:164115235-164115257 |
| Sequence | ATAATCAGTCATGAGCAATG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 174 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 163} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 983138372_983138373 | -3 | Left | 983138372 | 4:164115215-164115237 | CCATTACTTAAGAATGAGCAATA | 0: 1 1: 0 2: 0 3: 13 4: 186 |
||
| Right | 983138373 | 4:164115235-164115257 | ATAATCAGTCATGAGCAATGAGG | 0: 1 1: 0 2: 0 3: 10 4: 163 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 983138373 | Original CRISPR | ATAATCAGTCATGAGCAATG AGG | Intronic | ||