ID: 983138793

View in Genome Browser
Species Human (GRCh38)
Location 4:164122350-164122372
Sequence CAAGCTGCAGACATAGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 1, 2: 13, 3: 65, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983138791_983138793 6 Left 983138791 4:164122321-164122343 CCTTTCTAACTAAGAGTAGCCTG 0: 1
1: 3
2: 39
3: 50
4: 97
Right 983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG 0: 1
1: 1
2: 13
3: 65
4: 203
983138790_983138793 18 Left 983138790 4:164122309-164122331 CCAACTTATTTTCCTTTCTAACT 0: 1
1: 1
2: 30
3: 98
4: 817
Right 983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG 0: 1
1: 1
2: 13
3: 65
4: 203
983138788_983138793 20 Left 983138788 4:164122307-164122329 CCCCAACTTATTTTCCTTTCTAA 0: 2
1: 24
2: 52
3: 188
4: 819
Right 983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG 0: 1
1: 1
2: 13
3: 65
4: 203
983138789_983138793 19 Left 983138789 4:164122308-164122330 CCCAACTTATTTTCCTTTCTAAC 0: 2
1: 23
2: 47
3: 185
4: 680
Right 983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG 0: 1
1: 1
2: 13
3: 65
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983138793 Original CRISPR CAAGCTGCAGACATAGATAT TGG Intronic
901179281 1:7330062-7330084 CAGGCAGCAGACATGGAGATAGG + Intronic
906540634 1:46583188-46583210 GAAGCTGCAGGCCCAGATATAGG + Intronic
906548654 1:46641927-46641949 CAGGCTGGAGATATAAATATGGG - Intronic
907321954 1:53608482-53608504 CAAGCTCCATAGCTAGATATAGG - Intronic
907582558 1:55585028-55585050 AAAGCTGCAGACGCAGATATTGG - Intergenic
910189716 1:84583241-84583263 CAAGCTGCAGACATAGATGCCGG + Intergenic
910280196 1:85491399-85491421 CAAACTGCAGACAAAGACAAAGG + Intronic
910365611 1:86461766-86461788 CAACCGGCAGACATAGATAAGGG - Intergenic
911582791 1:99653604-99653626 CTAGATGCAGACATAATTATTGG + Intronic
912132350 1:106619103-106619125 TAAGCTGCAGACATAAATTTAGG + Intergenic
912627133 1:111214724-111214746 GAAGCTGCAGGCACAGATAAAGG - Intronic
912784482 1:112586959-112586981 CAAGAGGCAGAAATAGATTTGGG - Intronic
914355920 1:146884534-146884556 CAGGCTGCAGATAAAGATTTGGG - Intergenic
916336050 1:163672338-163672360 CCAGCTGCAGACCTAGATACCGG - Intergenic
918257392 1:182761644-182761666 CAGACTGCAGGCATAGATAAGGG - Intergenic
918685378 1:187408446-187408468 CAAGTTGCAGGCACAGATAAGGG - Intergenic
918702789 1:187626444-187626466 CAAGCTGCAGACGTAGATGCTGG - Intergenic
920224044 1:204425037-204425059 CCAACTGCAAACATAGAGATGGG + Exonic
920372234 1:205486261-205486283 CAAGCTGCAGACAGAGACAGAGG - Intergenic
921148429 1:212380676-212380698 CCAGAAGCAGACATAGATATTGG - Intronic
924238086 1:242015752-242015774 CAACCTGCAGACTATGATATGGG + Intergenic
924821104 1:247491538-247491560 CCAGCTGCAGGCAGAGATGTGGG - Intergenic
1064548327 10:16473727-16473749 GAAGCTGCTGAAAGAGATATTGG + Intronic
1064624381 10:17247391-17247413 CAAGCTGCAGGCACAGATAAGGG + Intergenic
1064796579 10:19018825-19018847 GAAGATGCAGACATAGGAATAGG - Intergenic
1065741743 10:28803178-28803200 CCAGCTGCAAAAATAGATACTGG + Intergenic
1067346032 10:45439871-45439893 CAAGCTGCAGACCCTGATCTGGG + Intronic
1068479699 10:57575215-57575237 TGAGCTGCAGACATAGATACTGG - Intergenic
1068674183 10:59753027-59753049 CAAGCTGCAGCCACAGGTCTTGG + Intergenic
1069547585 10:69339557-69339579 CAGGCTGCAGACACAGAGAACGG - Intronic
1075980112 10:126730955-126730977 CATGCTGCTGACACAGTTATTGG - Intergenic
1077760269 11:5087600-5087622 AAAGCTACAGACACAGATAAGGG - Intergenic
1078944286 11:16046410-16046432 CAACCTGCAGCCATAGATTTGGG - Intronic
1079644821 11:22850185-22850207 CGAGCTGCAGACATAGATGCTGG - Intronic
1081023516 11:37978689-37978711 CATGCTGCAGACTTACATCTGGG - Intergenic
1088141742 11:106625144-106625166 CAAACAGCTGACATAAATATTGG + Intergenic
1088193656 11:107253101-107253123 CAGGCTGCAGATATAGATGCTGG - Intergenic
1088698230 11:112388679-112388701 CAACCTGCAGGCACAGATAAGGG + Intergenic
1091274147 11:134338691-134338713 CAAGCTGCAGACACAAAAATTGG - Intronic
1093421683 12:18981149-18981171 CGAGCTGCAGACATAGCTGCTGG - Intergenic
1098147861 12:67516103-67516125 CAAGCTGCAGAAATGGATTTTGG + Intergenic
1101490347 12:105204209-105204231 CAACCAGCAGACATAGAAAATGG - Intronic
1101860369 12:108477673-108477695 CGAGCGGCAGACATAGATGCCGG + Intergenic
1101863875 12:108505184-108505206 CAAGCGTCAGACATAGATGCCGG + Intergenic
1102930908 12:116861463-116861485 CAACCTGCAGAAATAAAGATTGG + Exonic
1103877868 12:124142651-124142673 CAAGCTGCAGGCACAGATGAGGG + Intronic
1104233841 12:126912144-126912166 CAAGCAACAGGCATAGCTATTGG + Intergenic
1104351195 12:128045411-128045433 CGAGCTGCAGACATAGATATTGG - Intergenic
1106455969 13:29927216-29927238 CAAGCTGCAGATCTACAGATGGG + Intergenic
1106725046 13:32475683-32475705 AGAGCTGCAGACATAGATACTGG - Intronic
1107117482 13:36762587-36762609 CGAGCTGCAGACATAGATGCTGG - Intergenic
1108055110 13:46477792-46477814 TGAGCTGCAGACATAGATCCTGG - Intergenic
1108609148 13:52067379-52067401 CAAGCTGCAGACACAGATAAGGG + Intronic
1108894499 13:55307790-55307812 CCAGCTGCAGACCTAGAGAGAGG + Intergenic
1110975861 13:81833191-81833213 TGAGCTGCAGACATAGATACCGG - Intergenic
1112319306 13:98392565-98392587 CAAGATGCAGAATTATATATGGG - Intronic
1112630050 13:101150495-101150517 CAAGCTACAGACACAGAAAAAGG + Intronic
1113125277 13:106971451-106971473 GAAGGTGCAGACAGAGATACAGG + Intergenic
1113733071 13:112656553-112656575 CGAGCTGCAGACATAGATGCAGG + Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1115315535 14:32021183-32021205 CAAGCTGCAGGCACAGATAAGGG - Intergenic
1116514099 14:45785423-45785445 CAAGCTGCAGGTACAGATAAGGG + Intergenic
1116514889 14:45793198-45793220 CAAGCTCCAGGCACAGATAAGGG + Intergenic
1118243191 14:64081730-64081752 CAAGCAGTAGACATGGATTTTGG + Intronic
1118518298 14:66551489-66551511 CTAGCTCAAGACTTAGATATAGG - Intronic
1119514977 14:75240847-75240869 CAAGCGGGAGACATAGATGGAGG - Intronic
1120290422 14:82563153-82563175 CCAGCTGGAGTCCTAGATATTGG - Intergenic
1120840289 14:89079508-89079530 CAAGCTGCAGAGATAGGCAGGGG - Intergenic
1121996659 14:98608173-98608195 CCAGCTGCAGACACAGATACAGG - Intergenic
1122070048 14:99200389-99200411 CTGGCTCCAGCCATAGATATTGG - Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123554523 15:21414585-21414607 TAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1123693552 15:22859693-22859715 CAAGATCCAGACATCAATATGGG - Intronic
1126068091 15:44841704-44841726 CAAGCTACAGGCACAGATAAGGG + Intergenic
1126091763 15:45059072-45059094 CAAGCTACAGGCACAGATAAGGG - Intronic
1126166075 15:45655028-45655050 CGAGCTGCAGACATAGATGCTGG - Intronic
1127220330 15:56873706-56873728 CAAGCTGGAGATATAGATTTGGG + Intronic
1129092468 15:73166035-73166057 CAAGCTGCAGGCACAGATAAGGG - Intronic
1132146706 15:99433576-99433598 GAAGCTGCAGAAATAGCTCTGGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133207840 16:4244429-4244451 CGAGCTGCAGACATAGATGCAGG + Intergenic
1133500964 16:6366132-6366154 CTAGATACAGACATAGATACAGG - Intronic
1135386011 16:22040768-22040790 AAAGCTGCAGCCCTAGAGATAGG + Intronic
1135808847 16:25569248-25569270 CAACCTGCAGGCACAGATAAGGG - Intergenic
1136423340 16:30151500-30151522 CGAGCTGCAGACATAGATGTTGG - Intergenic
1139154275 16:64422117-64422139 CAAGCTGCAGGCACAGATAAGGG - Intergenic
1139978096 16:70830910-70830932 CAGGCTGCAGATAAAGATTTGGG + Intronic
1141004659 16:80340659-80340681 TAGGCTGCAGACACAGATGTAGG + Intergenic
1141037646 16:80642565-80642587 CACGCTGCTGACAAAGACATCGG + Intronic
1141362500 16:83409226-83409248 TAAGCTTCAGAGAAAGATATGGG + Intronic
1141514686 16:84535892-84535914 CGAGTTACAGACATAGATACTGG + Intronic
1143271262 17:5676760-5676782 CAGGCTTCAGAGTTAGATATGGG - Intergenic
1145009348 17:19358796-19358818 CAGGCTGGAGACATAAATTTGGG - Intronic
1146498797 17:33346687-33346709 AAAGCTGAAGATATAGATCTGGG + Intronic
1149251427 17:54774561-54774583 CAATTTGCAGACAGTGATATGGG - Intergenic
1149988816 17:61368839-61368861 CACGCTGGAGACTTAGAGATTGG + Intronic
1150498539 17:65628214-65628236 GAAGCTGCTGAAATAGAAATGGG - Intronic
1153232109 18:2948296-2948318 CAAGCTGCTGGCTTAGAGATAGG + Intronic
1153310909 18:3676093-3676115 CAAGCTGCAGACATAGATGCCGG + Intronic
1153583126 18:6595523-6595545 CATGCTGCAGACACAGCCATAGG + Intergenic
1153661168 18:7327577-7327599 CAGGCTGGAGACATAAATTTGGG + Intergenic
1153834642 18:8952947-8952969 CAAGCAGAAGGCATAGAGATGGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1157144750 18:45150476-45150498 TAAGCTCCAGGCATAGTTATGGG - Intergenic
1157595056 18:48859325-48859347 GCAGCTGCAGACAGAGATGTGGG - Exonic
1157814429 18:50720669-50720691 CAAGCTGCAGACAGAGATGGTGG - Intronic
1158288683 18:55914524-55914546 GAAGCTGCAGATGTAGATCTTGG + Intergenic
1159139952 18:64381625-64381647 TGAGCTGCAGACATAGATGCTGG + Intergenic
1160906266 19:1453112-1453134 CAAGCTGGAGACAGAGACGTCGG + Exonic
1160914492 19:1490233-1490255 CCAGCTGCTGACATAGATGGGGG + Exonic
1166456196 19:42942032-42942054 CAAGATGCAGAGATAGGTAGTGG + Intronic
1167723104 19:51192392-51192414 AAAGCCACAGACATAGATACTGG - Intergenic
1167761102 19:51449873-51449895 AAAGCCACAGACATAGATACTGG + Intergenic
1168541900 19:57219781-57219803 CAGTCTGGAGACATAGATTTGGG - Exonic
1168546958 19:57260721-57260743 CAACCTGGAGACACAGATTTAGG - Intergenic
925118680 2:1401124-1401146 CAACCTGCAGGCACAGATATGGG - Intronic
925472458 2:4176729-4176751 CAAACTGCAGACATAGATGCTGG - Intergenic
925628594 2:5866436-5866458 CAATCTGCAGTCATAGACACTGG - Intergenic
925723168 2:6847527-6847549 CAAGCTGCAGGCACTGATAAGGG - Intronic
926034146 2:9621563-9621585 CAAGCTGAAGACATAAGTACAGG + Intronic
926857709 2:17274868-17274890 AAAGCTGCACACCTACATATTGG + Intergenic
929300145 2:40294530-40294552 CAAGTTGCATATATATATATGGG + Intronic
930113074 2:47695571-47695593 CATGCTGCAGGCACAGATAAGGG - Intronic
935136340 2:100306533-100306555 CCATTTGCAGAAATAGATATAGG - Intronic
935363700 2:102268405-102268427 GAAGCTGCAGACATGGATGTGGG - Intergenic
935877733 2:107529578-107529600 CAAGCTGCAGATATAGATGCTGG - Intergenic
937798717 2:126056600-126056622 CAAGCTGCAGACATAGATGCTGG + Intergenic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939800071 2:146697447-146697469 CAAGCTACAGGCATAGATAAGGG - Intergenic
942947620 2:181686787-181686809 CATGCTGCAGACATGAATTTTGG + Intergenic
944952196 2:204764437-204764459 CAAGCTGCAGGCACAGAAAAGGG - Intronic
948434025 2:237940392-237940414 CAGCCTGCAGGCATAGATAAGGG - Intergenic
1174633416 20:51978199-51978221 CAAGCTGCAGGTACAGATAAGGG + Intergenic
1174956406 20:55103449-55103471 CAGCCTGCAGGCATAGATAAGGG - Intergenic
1175273370 20:57750363-57750385 CCTGCTGCAGACATAAATTTGGG - Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177400092 21:20592698-20592720 CAAGCTGCAGGCATAGATAAGGG - Intergenic
1177673974 21:24272534-24272556 CAAGCTGCAAGCATAGATAAGGG + Intergenic
1178009346 21:28264863-28264885 CAAGAAACAGACATAGTTATAGG + Intergenic
1178114082 21:29399112-29399134 CAGGCTGGAGATATACATATAGG - Intronic
1178285849 21:31324760-31324782 CAGGCTGGAGACAAAGATTTTGG + Intronic
1178819758 21:35964275-35964297 CAAGCTGCCAACATAGATGCTGG - Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
952261297 3:31742949-31742971 CAAGCTGCTGAAGTAGATTTAGG + Intronic
952628777 3:35439810-35439832 CAAGCTGCAGGCACAGATAAGGG + Intergenic
955167431 3:56528146-56528168 AAAGCTGAAGACATGGGTATAGG + Intergenic
957014682 3:75048925-75048947 CAAGCTGCAGGCATAGATAAGGG - Intergenic
958486895 3:94724141-94724163 TAAGCCACAAACATAGATATTGG + Intergenic
959181036 3:102980565-102980587 TAAGCTGCAGGCACAGATAAGGG - Intergenic
959738185 3:109685198-109685220 CAAGCTGCAGGCACCGATAAGGG + Intergenic
960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG + Intergenic
960610072 3:119547723-119547745 TAGGCTGCAAACATAGATTTAGG - Intronic
960701777 3:120446642-120446664 GAAGATGCAGTCAGAGATATGGG + Intronic
961552911 3:127679360-127679382 CAAGCTGCAGACAGAGACAAGGG - Intronic
963004638 3:140715064-140715086 CGAGCTGCAGACATAGATACTGG + Intergenic
964962197 3:162440207-162440229 CGATCTGCAGACATAGATACCGG - Intergenic
965102588 3:164320058-164320080 TAAGCTGCAGAGATAGAAATTGG - Intergenic
971456708 4:26851990-26852012 CAAGCTGGAGATTTAGATTTAGG - Intergenic
971752543 4:30668861-30668883 CAAGCTACAGAGAGAGACATGGG - Intergenic
972536738 4:40006300-40006322 AGAGCTGCAGACATAGATGCCGG - Intergenic
972673072 4:41232490-41232512 CCAGCTGGAGATATAAATATGGG + Intergenic
973744073 4:53946321-53946343 CAAGCAGCAGACATTGATGCTGG - Intronic
973893038 4:55386982-55387004 CAAGCTGCAGGCACAGATAAGGG + Intergenic
975622006 4:76305721-76305743 TGAGCTGCAGACATAGACGTGGG + Intronic
975687819 4:76934667-76934689 CAAGTGGCAGACATAGACACTGG - Intergenic
978346980 4:107781225-107781247 CAAGCAGCAGTCACATATATTGG + Intergenic
982671667 4:158327567-158327589 TGAGCTGCAGACATAGATGCTGG + Intronic
983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG + Intronic
983773301 4:171576192-171576214 CAAGCCTATGACATAGATATTGG - Intergenic
984111085 4:175615175-175615197 CGAACTGCAGACATAGATGCTGG - Intergenic
984218093 4:176939729-176939751 CAAGCTGAAGACATTGCTACTGG - Intergenic
984448175 4:179865218-179865240 CAAGCTGAAGATAAGGATATGGG - Intergenic
984541534 4:181042893-181042915 AAAGATGCAGACATAAAGATTGG - Intergenic
988255914 5:28819775-28819797 AAATGTGTAGACATAGATATAGG - Intergenic
989700316 5:44256374-44256396 CCAGCTGAATACATAGATAAAGG + Intergenic
989717287 5:44479239-44479261 CAGCCTGCAGACAGAGATAAGGG + Intergenic
994584460 5:101688383-101688405 AAAGCTGAACACATAGAAATAGG - Intergenic
995109571 5:108413817-108413839 CAAGGAGCAAACAAAGATATAGG + Intergenic
996205516 5:120730448-120730470 TAAGCTGAATACATAGATTTGGG + Intergenic
997756242 5:136402032-136402054 CAAGATGAAAACATAAATATGGG + Intergenic
998315389 5:141178503-141178525 AATGCTGAAGACTTAGATATAGG + Exonic
998586944 5:143437436-143437458 CAAGTTGCTGACATAAATTTCGG - Intergenic
1000503999 5:162091198-162091220 GAAGCAGCATACATAGATGTAGG + Intronic
1000854090 5:166378405-166378427 TGAGCTGCAGACATAGATAATGG - Intergenic
1003045882 6:2732349-2732371 CAAGCTGCAGAGATTTACATAGG + Intronic
1004248668 6:14003974-14003996 CTAGATGCAGACATACATACAGG - Intergenic
1004368759 6:15034155-15034177 CGAGCTGCAGACATAGATGCCGG - Intergenic
1004707936 6:18141860-18141882 CGAGCTGCAGACATAGATGCCGG + Intronic
1004885366 6:20046251-20046273 AAATCTGCATACATAGATCTAGG - Intergenic
1004900467 6:20188860-20188882 CAACCTGCAGGCACAGATAAAGG - Intronic
1005197129 6:23300562-23300584 CAACCTGCAGGCATAGATAAGGG + Intergenic
1005783200 6:29215645-29215667 CCAGCTGCAGACAAAGTTTTGGG - Intergenic
1005985992 6:30875356-30875378 CGGGCTGCAGACATAGATGACGG + Intergenic
1006573995 6:35030233-35030255 CTAACTGCAGACAAAAATATTGG + Intronic
1007013512 6:38440113-38440135 CAAGCTGGATATATAGATTTGGG + Intronic
1007340753 6:41190104-41190126 CAAGCTGCAGGCACAGATATGGG - Intergenic
1007835470 6:44670698-44670720 CAAGCTGCAGAGCCAGATTTGGG + Intergenic
1008723972 6:54393677-54393699 CCAACTGCAGACATAGACGTTGG - Intergenic
1009650967 6:66478198-66478220 CTAGCTTCAGACACAGACATAGG - Intergenic
1009657191 6:66562321-66562343 CAAGCTACCCACATAGATACTGG - Intergenic
1009708104 6:67281527-67281549 CAACCTGCATACAGAGATAATGG + Intergenic
1009823573 6:68837640-68837662 CTAGCTGAAGAAATAGATATGGG + Intronic
1011124634 6:83993922-83993944 CAAGCTGCAGACAAAGGTTATGG - Intergenic
1013293536 6:108738931-108738953 CGAGCTGCAGACATACATGCAGG - Intergenic
1013887402 6:114986990-114987012 CTAGCTACAGACAAAAATATGGG + Intergenic
1014310696 6:119797604-119797626 CAAGCTGCAAACATATAAAATGG - Intergenic
1014585690 6:123194986-123195008 GAATCAGCAGACATAGACATTGG + Intergenic
1016502481 6:144737056-144737078 CAAGCTTCAGACACAGACATTGG - Intronic
1016557950 6:145360899-145360921 CGAGCTGCAGACATAGATGTTGG + Intergenic
1018135724 6:160777102-160777124 CAGGTTGAAGACATGGATATGGG + Intergenic
1018388890 6:163328295-163328317 CGAGCTGCAGACATAGATGCCGG - Intergenic
1018399962 6:163413115-163413137 CAAAATGCAGACGTAGATTTAGG + Intergenic
1025715255 7:63950117-63950139 CAGGCTGCAGACAAAGCTGTGGG - Intergenic
1026095704 7:67344902-67344924 CAAGCTGCAGGCACAAATAAGGG + Intergenic
1026339017 7:69419597-69419619 TAACCTGCAGTCAGAGATATTGG + Intergenic
1027540631 7:79459631-79459653 TGAGCTGCAGAGATATATATGGG + Intergenic
1028201553 7:87967865-87967887 CAAGGTGCTTACAGAGATATTGG + Intronic
1028351511 7:89856154-89856176 CGAACTGCAGACATAGATGCTGG + Intergenic
1028352294 7:89863555-89863577 TGAGCTGCAGACATAGATGCCGG + Intergenic
1030604235 7:111622299-111622321 CAAGCTGCAGGCACAGATAAGGG + Intergenic
1031111475 7:117615155-117615177 GAAGCTGCATACATAATTATTGG + Intronic
1031415651 7:121493349-121493371 CATGCTGCATGCATAGTTATAGG + Intergenic
1031534358 7:122915116-122915138 CGAGCTGCAGACATAGATGCTGG - Intergenic
1031864003 7:127017470-127017492 CAAGCTGCAGAAATAGCCCTTGG + Intronic
1032447494 7:131997138-131997160 CTAGCTGAAGACATAAATTTGGG - Intergenic
1032468115 7:132159472-132159494 AAAGCTGCAGATATGGATCTGGG - Exonic
1032864100 7:135908862-135908884 AAAGTTGCAGAAATAGATAGTGG + Intergenic
1033066941 7:138164995-138165017 CAAGCTGCAGGCACAGATAAGGG - Intergenic
1033096031 7:138431761-138431783 CAAGCAGCAGGCACAGATAAGGG - Intergenic
1034736461 7:153433484-153433506 CGAGCTGCAGACATAGATGCTGG - Intergenic
1035088517 7:156283470-156283492 CAACCTGAAGACATAGCAATAGG - Intergenic
1036047911 8:5164626-5164648 TAAGCTGCAGGCATAGATAAGGG - Intergenic
1036217659 8:6894119-6894141 CAAGCTGCAGACAATGAGTTGGG + Intergenic
1037291744 8:17357729-17357751 CAAACTGCAGACATTGATGCTGG + Intronic
1037650311 8:20831462-20831484 CAAGCTGAATATATATATATTGG - Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040623000 8:49110515-49110537 CAAGCTGCAGGCACAGATAAGGG + Intergenic
1040977175 8:53206361-53206383 CAGGCTGCAGAGAGTGATATTGG + Intergenic
1041177443 8:55211058-55211080 CAAGTTGCAGGCACAGATAAGGG - Intronic
1043681427 8:83030639-83030661 TAAGTTGCAGACATATATAATGG - Intergenic
1047300610 8:123610611-123610633 CAGGCTGAAGAAATAGATAAAGG + Intergenic
1048052006 8:130827266-130827288 CCAGCTGCAGACACAGATGCTGG + Intronic
1048673274 8:136747617-136747639 TGAGCTGCAGACATAGATGCTGG - Intergenic
1048810018 8:138277075-138277097 CGAGCTGCAGACACAGGTCTTGG - Intronic
1049013595 8:139904514-139904536 CAAGGTGCAGACATAGCTTCTGG - Intronic
1050434919 9:5599036-5599058 CAAGTTGCAGGCATAGATAAGGG + Intergenic
1050619923 9:7441724-7441746 CAAGCTGCAATCATAGCTTTAGG - Intergenic
1050915652 9:11127733-11127755 CAAACTTCAGACATAGCTACTGG + Intergenic
1052984651 9:34477867-34477889 TAAGCTGCAGAAATAGATCTGGG + Intronic
1053083271 9:35195202-35195224 CAAGCTGCAGACATACATGCTGG - Intronic
1053166584 9:35848199-35848221 CATGCTGCAGAGAGAGATCTTGG + Intronic
1055028990 9:71753028-71753050 CAAGCAGCAGACAAAAATAATGG + Intronic
1056640731 9:88368355-88368377 CAAGCTTCAGGCACAGATAAGGG + Intergenic
1058590402 9:106558886-106558908 ACAGATGCAGATATAGATATAGG + Intergenic
1059202123 9:112427863-112427885 CACGCAGCAGACATGGGTATTGG + Intronic
1059464420 9:114458713-114458735 CATGATGCAGACACAGATCTAGG - Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1185694081 X:2181845-2181867 CTAGGTACAGACACAGATATGGG - Intergenic
1186116675 X:6311201-6311223 CAGCCTGCAGACACAGATAAGGG - Intergenic
1186165900 X:6825587-6825609 CAAGCTGGAGACTTAGAGGTGGG - Intergenic
1186168548 X:6853199-6853221 CAGCCTGTAGACATAGATAAGGG - Intergenic
1187863035 X:23699733-23699755 CAAGCTGCAGGCACCGATAAGGG + Intergenic
1188816004 X:34715091-34715113 TAAGCTCCAGACATTGATATTGG + Intergenic
1189477540 X:41367618-41367640 GAAGCTGCAGACAGCGCTATGGG - Intergenic
1189580826 X:42404445-42404467 CAAGCTGCAGACATAGATGCTGG - Intergenic
1192522078 X:71811364-71811386 CAACCTGTAGAGATAGATAGTGG - Intergenic
1193791420 X:85819833-85819855 TGAGCTGCAGACATAGATGCTGG + Intergenic
1193919624 X:87409308-87409330 CAGGCTGCAGGCACAGATAAGGG + Intergenic
1194435967 X:93868805-93868827 CAAGCTGCAGGCACAGATAAGGG - Intergenic
1194482151 X:94439777-94439799 TGAGCTGCAGACATAGATGCCGG - Intergenic
1195255204 X:103083070-103083092 CCAGCTGCAGAGTTAGAGATGGG + Exonic
1196612186 X:117727814-117727836 CAAGATACAGACATAGTTACTGG - Intergenic
1196979596 X:121196989-121197011 CAAGCTGCAGGCACCGATAAGGG + Intergenic
1197331869 X:125162769-125162791 CAAGCTGCAGATGTAGATATGGG - Intergenic
1197800436 X:130341985-130342007 CAGGCTGCATACATAGGTAAAGG + Intronic
1198417042 X:136430826-136430848 CAAGCTGGAGATATAAATTTGGG + Intergenic
1199135321 X:144243508-144243530 CGAGCTGCAGACATAGATACTGG + Intergenic
1199878769 X:151956115-151956137 CAACCTGCAGAGACAGACATTGG - Intronic