ID: 983139535

View in Genome Browser
Species Human (GRCh38)
Location 4:164132536-164132558
Sequence ATGCAGTTATTTAGTTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 431}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983139534_983139535 3 Left 983139534 4:164132510-164132532 CCACTATTAGTGATCATCAACTA 0: 1
1: 0
2: 0
3: 10
4: 85
Right 983139535 4:164132536-164132558 ATGCAGTTATTTAGTTAAGATGG 0: 1
1: 0
2: 0
3: 24
4: 431
983139532_983139535 10 Left 983139532 4:164132503-164132525 CCTTGACCCACTATTAGTGATCA 0: 1
1: 0
2: 0
3: 2
4: 72
Right 983139535 4:164132536-164132558 ATGCAGTTATTTAGTTAAGATGG 0: 1
1: 0
2: 0
3: 24
4: 431
983139533_983139535 4 Left 983139533 4:164132509-164132531 CCCACTATTAGTGATCATCAACT 0: 1
1: 0
2: 1
3: 9
4: 100
Right 983139535 4:164132536-164132558 ATGCAGTTATTTAGTTAAGATGG 0: 1
1: 0
2: 0
3: 24
4: 431
983139531_983139535 13 Left 983139531 4:164132500-164132522 CCACCTTGACCCACTATTAGTGA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 983139535 4:164132536-164132558 ATGCAGTTATTTAGTTAAGATGG 0: 1
1: 0
2: 0
3: 24
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983139535 Original CRISPR ATGCAGTTATTTAGTTAAGA TGG Intronic
902044775 1:13516006-13516028 ATGCAAGTATTTAGTTGACAAGG + Intergenic
902069619 1:13723228-13723250 GTGCAGTGCTTTAGTTAGGATGG - Intronic
902912651 1:19612045-19612067 ATTCATTTATTTATTTGAGACGG + Intronic
904157919 1:28500282-28500304 ATGCAATTATTTATTTTACAAGG - Exonic
904175962 1:28629064-28629086 ATTCATTTATTTATTTGAGACGG - Intronic
905833753 1:41098345-41098367 ATGCTGTTATTTTGTGAATAAGG - Intronic
906123340 1:43410378-43410400 TTGTAGTTTTTTAGTAAAGATGG - Intronic
906984781 1:50671560-50671582 TGGCAGTTTTTTATTTAAGAGGG + Intronic
908002509 1:59694282-59694304 ATTTATTTATTTATTTAAGACGG - Intronic
908021629 1:59904288-59904310 ATGTATTTATTTATTTGAGATGG - Intronic
908058061 1:60313889-60313911 ATTTATTTATTTATTTAAGATGG + Intergenic
908596673 1:65695926-65695948 ATTCATTTATTTTTTTAAGACGG + Intergenic
909707582 1:78605680-78605702 TTGTAGTTTTTTAGTAAAGACGG - Intergenic
909738644 1:78999566-78999588 ATTTATTTATTTATTTAAGACGG - Intronic
910074496 1:83261381-83261403 ATGCAGTTATTTATACAGGAAGG - Intergenic
911288376 1:96026220-96026242 ATTTATTTATTTAGTAAAGACGG - Intergenic
912238422 1:107878708-107878730 ACTCAATCATTTAGTTAAGATGG + Intronic
912438050 1:109675636-109675658 ATGCAGTCATATAGTGGAGAAGG - Intronic
913071395 1:115302226-115302248 ATGTAGTGTTTTATTTAAGAAGG + Intronic
913292876 1:117291597-117291619 ATTTATTTATTTATTTAAGATGG + Intergenic
914372202 1:147036651-147036673 ATTTATTTATTTATTTAAGACGG + Intergenic
914711280 1:150215991-150216013 ATTTATTTATTTATTTAAGATGG + Intergenic
915441656 1:155949246-155949268 ATTTATTTATTTATTTAAGATGG - Intronic
916938251 1:169653558-169653580 AAGCATTTATTAAGTTAATAAGG - Intergenic
917481847 1:175419039-175419061 TTGCAGTTATTTAGTCAGTAAGG + Intronic
917719388 1:177772305-177772327 ATGCAGTGGTTTAAATAAGAAGG + Intergenic
917746904 1:178018730-178018752 ATTTATTTATTTATTTAAGATGG - Intergenic
918692286 1:187496567-187496589 ATGCATTTTTTTGGTCAAGAGGG + Intergenic
918980260 1:191548159-191548181 ATGAAGTTTTTTTGTAAAGAGGG - Intergenic
919098881 1:193069283-193069305 ATAAAGTCATTTAGTCAAGAAGG + Exonic
919158796 1:193802205-193802227 TTGCAGTGATGTAGTAAAGAAGG - Intergenic
919189377 1:194196001-194196023 GTGCACTTAATTTGTTAAGAGGG + Intergenic
920242106 1:204560540-204560562 ATGGAGTTAGATACTTAAGACGG + Intergenic
921498784 1:215874781-215874803 ATGCAGACGTTAAGTTAAGAAGG + Intronic
921711532 1:218378173-218378195 ATTTATTTATTTATTTAAGATGG + Intronic
922062395 1:222104857-222104879 CTTCAGTTATTTCATTAAGATGG - Intergenic
923061509 1:230479339-230479361 ATGCAGTTATTTCAATCAGAAGG + Intergenic
923691703 1:236200140-236200162 ATGCATTTATATAGTTTTGAGGG + Intronic
923869704 1:237978033-237978055 ATGCAGTTTTTTCCATAAGAAGG - Intergenic
1063520901 10:6739689-6739711 ATGCATTTATTTATTTGAGATGG - Intergenic
1064442473 10:15366122-15366144 ATGTATTTATTTATTTGAGATGG + Intronic
1065265827 10:23974447-23974469 ATGCGGTTATTAATTTAAAAGGG + Intronic
1065308457 10:24391064-24391086 AAGCAATTGTTTAGTTAATATGG + Intronic
1065657888 10:27970965-27970987 ATTTATTTATTTATTTAAGATGG - Intronic
1065912728 10:30323512-30323534 ATGTATTTATTTATTTGAGACGG + Intronic
1066209390 10:33222523-33222545 ATTTATTTATTTATTTAAGATGG + Intronic
1067318304 10:45191837-45191859 ATGCAGTTAATAAGTTTAAATGG - Intergenic
1068613037 10:59081658-59081680 ATATAAATATTTAGTTAAGACGG + Intergenic
1069538368 10:69273218-69273240 ATTCATTTATTTATTTGAGATGG + Intronic
1070395164 10:76005922-76005944 ATTTATTTATTTATTTAAGATGG - Intronic
1070477318 10:76842379-76842401 TTCCAGCTATTTAGTTGAGAAGG - Intergenic
1071367605 10:84915703-84915725 ATTTATTTATTTATTTAAGATGG + Intergenic
1071531886 10:86396038-86396060 ATGAAGTTATTTGTTTAAAAAGG - Intergenic
1072080483 10:92025104-92025126 ATGTAGTTCTATAGTTAAAAAGG - Intronic
1072768645 10:98117417-98117439 ATGTATTTATTTATTTTAGATGG + Intergenic
1073942041 10:108710656-108710678 AAACACTTATTTAGTTAAGGTGG - Intergenic
1074667487 10:115745998-115746020 ATGGAGTTATTTCACTAAGAAGG - Intronic
1075908651 10:126104821-126104843 AAGCAGTTATTAAGTTAGAATGG + Intronic
1077966599 11:7140376-7140398 AAGCAGTTATATAGATAGGAAGG - Intergenic
1078041991 11:7874424-7874446 AGAAAGTTATTTAGTTAAGTTGG + Intergenic
1078598503 11:12710562-12710584 ATTCATTTATTTAATAAAGAGGG + Intronic
1078634108 11:13032989-13033011 ATGCATTTAGTAATTTAAGATGG - Intergenic
1078693623 11:13606978-13607000 AAGAGGTTATTTAGATAAGATGG - Intergenic
1080268816 11:30428603-30428625 GTGCAATGATTAAGTTAAGAGGG + Intronic
1080480390 11:32642557-32642579 ATGAAGTAATTAAGTTAATATGG - Intronic
1080550295 11:33368653-33368675 ATTTATTTATTTATTTAAGAGGG - Intergenic
1081545996 11:44072160-44072182 ATTTATTTATTTATTTAAGATGG + Intronic
1081632433 11:44699060-44699082 AGGCAGGTGATTAGTTAAGAGGG - Intergenic
1082664018 11:55950830-55950852 ATTCATTTATTTATTTGAGATGG - Intergenic
1083330152 11:61893771-61893793 ATGTATTTATTTATTAAAGACGG - Intergenic
1083686352 11:64378194-64378216 ATACAGATTTTTAGTTAAAATGG + Intergenic
1084041404 11:66545038-66545060 ATGTATTTATTTATTTGAGACGG + Intronic
1084622807 11:70285009-70285031 ATGTATTTCTTTATTTAAGATGG + Intronic
1084715480 11:70870779-70870801 ATTCATTTATTTATTTGAGATGG + Intronic
1085577621 11:77620975-77620997 ATTTATTTATTTATTTAAGACGG - Intronic
1086196768 11:84149744-84149766 ATTCATTTATTTATTTAAGATGG + Intronic
1086338011 11:85818695-85818717 ATCTATTTATTTATTTAAGACGG + Intergenic
1086787868 11:90994638-90994660 ATGCAGTTAATTTTTTTAGATGG - Intergenic
1086788418 11:91002543-91002565 ATGCATTTATTTATTAGAGATGG - Intergenic
1087333290 11:96811361-96811383 ATGCAGTTATTTGGATAAATAGG - Intergenic
1088403969 11:109451470-109451492 TTGCATTTATTTATTTAAGATGG + Intergenic
1088471359 11:110190449-110190471 ATTTATTTATTTATTTAAGATGG - Intronic
1091000187 11:131904539-131904561 ATCCAGTGATTTGTTTAAGATGG + Intronic
1092997191 12:13961569-13961591 ATTTAGTTATTCAGTTAAAATGG - Intronic
1094365054 12:29671293-29671315 ATTTATTTATTTATTTAAGATGG - Intronic
1095897427 12:47293812-47293834 ATGCAGTCATTTAAATAAAAAGG - Intergenic
1096643082 12:53010396-53010418 ATGCATTTTTTTACTTGAGAAGG + Intronic
1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG + Intronic
1097472546 12:60012857-60012879 ATTCAGCAATTTAGTTTAGAGGG + Intergenic
1098310021 12:69139235-69139257 ATGCAGTCATTGTATTAAGAAGG - Intergenic
1098453198 12:70643476-70643498 ATGCAGTTTTTTAGATAGGCTGG + Intronic
1099790843 12:87331193-87331215 ATTTATTTATTTATTTAAGATGG - Intergenic
1100756303 12:97754634-97754656 ATGCTCTTGTTTATTTAAGATGG - Intergenic
1101380558 12:104210732-104210754 ATTTATTTATTTATTTAAGACGG + Intergenic
1102365890 12:112334202-112334224 ATTTATTTATTTATTTAAGAGGG - Intronic
1103543312 12:121681603-121681625 ATTTATTTATTTATTTAAGATGG + Intergenic
1103629230 12:122246302-122246324 ATTTATTTATTTATTTAAGAGGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104188165 12:126452387-126452409 ATTCATTTATTTTTTTAAGATGG - Intergenic
1104345380 12:127991786-127991808 ATGCAGAAATTTATTTAAAAAGG - Intergenic
1108553145 13:51566539-51566561 ATTCAGTTATTTATTCAATAAGG + Intergenic
1109171361 13:59101189-59101211 ATCCAGTTATTAAATGAAGATGG + Intergenic
1109759360 13:66806959-66806981 ATTCAGTTATTTACATAATAGGG - Intronic
1110897205 13:80769263-80769285 ATGCAGATATTTACTACAGATGG + Intergenic
1111179737 13:84648301-84648323 ATGTAGTTTTTTTGTTAACATGG + Intergenic
1111270849 13:85882784-85882806 ATGTAGTTATTTATTTTGGAGGG + Intergenic
1112073824 13:95885912-95885934 TTGAAGAAATTTAGTTAAGAAGG + Intronic
1112724837 13:102291515-102291537 ATGCAGTTATTTATTTACTCTGG - Intronic
1113029119 13:105974536-105974558 ATTTATTTATTTATTTAAGATGG - Intergenic
1113069114 13:106402113-106402135 ATGCAGTTATTACTTTAAGATGG - Intergenic
1113981112 13:114276788-114276810 CTGCAGCTTTTTGGTTAAGAGGG - Intergenic
1114735675 14:25041310-25041332 ATGTATTTATTTATTTGAGATGG - Intronic
1115005868 14:28483868-28483890 ATGAAGTGATTTGGTTAAGCAGG - Intergenic
1115283745 14:31694518-31694540 ATACATTTATTTATTTATGATGG + Intronic
1116264723 14:42673764-42673786 ATGCTGTTATTTGGTTGAGGCGG - Intergenic
1118180621 14:63488842-63488864 ATTAATTTATTTATTTAAGATGG - Intronic
1119065161 14:71518313-71518335 ATGCAAGTCTTTAGTTAAGTTGG + Intronic
1119219502 14:72894385-72894407 CTGCAGTTATTTAGAAAAGTAGG - Intergenic
1119750352 14:77072923-77072945 AGGGAGTTATTTAGCTAAGATGG + Intergenic
1119806754 14:77487238-77487260 ATTTATTTATTTATTTAAGATGG - Intronic
1119848528 14:77848468-77848490 ATTTATTTATTTACTTAAGATGG + Intronic
1120830931 14:88996710-88996732 ATGAAGTCATTTAGGTGAGAGGG - Intergenic
1121333411 14:93062264-93062286 ATGCAGTTTTTTTTTTGAGATGG - Intronic
1123388778 15:19848035-19848057 ATTCATTTATTTATTTGAGATGG + Intergenic
1126017667 15:44368140-44368162 ATTTATTTATTTATTTAAGATGG + Intronic
1128009094 15:64274384-64274406 AAGCAGTTATTTATTTTAAATGG - Intronic
1129430205 15:75495017-75495039 ATTTATTTATTTATTTAAGATGG - Intronic
1130695386 15:86126159-86126181 ATAAAATTAATTAGTTAAGAGGG - Intergenic
1130761279 15:86822674-86822696 ATGCAGTTTTTCAGGAAAGAAGG + Intronic
1132360896 15:101214458-101214480 ATTCAGTTATTATTTTAAGATGG - Intronic
1133784902 16:8965851-8965873 ATGTATTTATTTATTTTAGATGG - Intergenic
1133978201 16:10615424-10615446 AAGCATTTATTTATTTGAGAAGG + Intergenic
1134857544 16:17533053-17533075 ATGATGCTATTTAGATAAGAGGG - Intergenic
1135706085 16:24676297-24676319 ATGTATTTATTTATTTAAGATGG + Intergenic
1137408887 16:48211233-48211255 ATACAGTTCTTTAGTTCAGCAGG + Intronic
1138814415 16:60187883-60187905 ATGTATTTATTTATTTAAGAAGG + Intergenic
1139575564 16:67839868-67839890 ATGTATTTATTTATTTGAGATGG - Intronic
1139723740 16:68878899-68878921 ATACTGTTTTTTGGTTAAGACGG - Intronic
1140885225 16:79237014-79237036 ATGCAGCTATTGGGTTAATAAGG - Intergenic
1140943795 16:79748653-79748675 ATGCAGTTAAATAGTGATGATGG + Intergenic
1141109473 16:81260510-81260532 ATTTATTTATTTATTTAAGATGG + Intronic
1142720594 17:1773246-1773268 ATTTATTTATTTATTTAAGATGG + Intronic
1143042758 17:4051423-4051445 ATGTATTTATTTATTTGAGATGG + Intronic
1143960954 17:10719279-10719301 ATTCATTTATTTATTTGAGACGG + Intronic
1144604988 17:16657118-16657140 ATGCAGGTATTTTGCTAAAAGGG - Intergenic
1144970648 17:19107177-19107199 ATTTATTTATTTATTTAAGATGG - Intergenic
1144990951 17:19233339-19233361 ATTTATTTATTTATTTAAGATGG - Intronic
1145053233 17:19680473-19680495 ATACATTTATTTATTTGAGATGG - Intronic
1145096993 17:20038570-20038592 TTGTAGTTTTTTAGTTGAGACGG + Intronic
1146069162 17:29663507-29663529 ATGCATTTACTTTGTTAAGTAGG + Intronic
1147206629 17:38841956-38841978 ATTCATTTATTTAGTAGAGATGG - Intergenic
1149012416 17:51871233-51871255 ATTTATTTATTTATTTAAGATGG + Intronic
1149123041 17:53193038-53193060 AGGTGGTTAATTAGTTAAGAAGG + Intergenic
1149799943 17:59557930-59557952 TTGCATTTTTTTAGTAAAGACGG + Intergenic
1149873313 17:60203578-60203600 ATTTATTTATTTATTTAAGACGG + Intronic
1150087097 17:62280828-62280850 ATTTATTTATTTATTTAAGACGG + Intronic
1150930547 17:69580052-69580074 AGGCAGATATTGAGGTAAGAAGG + Intergenic
1153134036 18:1892691-1892713 ATTCAGTCACTTAGTTAAGGTGG - Intergenic
1154113005 18:11586320-11586342 ATTCATTTATTTATTTGAGATGG - Intergenic
1155614390 18:27704253-27704275 ATGCAGTTATGCAATTTAGAAGG - Intergenic
1155644437 18:28060487-28060509 CTGCAGTTAATAAGTAAAGAAGG - Intronic
1155820078 18:30363555-30363577 ATTCATTTATTTATTTGAGACGG - Intergenic
1155885564 18:31204190-31204212 AAGCAGGTATTTAGTTAAGCAGG - Intergenic
1155936521 18:31760440-31760462 ATGCAGTACTTCAGTTGAGAAGG - Exonic
1156101650 18:33603534-33603556 ATAGAGTTAGTTAGATAAGAAGG + Intronic
1156248482 18:35327069-35327091 ATGCAGTACTTTAGTTCACATGG + Intergenic
1156381937 18:36570409-36570431 CTGGAGATATTTTGTTAAGAAGG - Intronic
1156877618 18:42034453-42034475 ATTCAGTTCATTAGTTCAGATGG + Intronic
1157659987 18:49432782-49432804 ATTCTGTTATTTGGTAAAGATGG + Intronic
1157839798 18:50946105-50946127 ATTTATTTATTTATTTAAGATGG - Intronic
1159099213 18:63939720-63939742 AATCTGTTATTTAGTGAAGAAGG + Intergenic
1159520905 18:69522029-69522051 TTTTAGTTATTTAGTAAAGATGG - Intronic
1159685566 18:71415052-71415074 ATTTATTTATTTATTTAAGATGG + Intergenic
1160461000 18:79037841-79037863 CTGAAGTTATTTATTTAATATGG + Intergenic
1161520139 19:4719321-4719343 ATTTATTTATTTATTTAAGACGG - Intronic
1161783343 19:6308076-6308098 ATTTATTTATTTATTTAAGATGG - Intronic
1161866803 19:6838904-6838926 ATTTATTTATTTATTTAAGATGG + Intronic
1163668790 19:18615610-18615632 ATTCATTTATTTATTTGAGATGG + Intronic
1164799690 19:31066415-31066437 AAGCAGTTATTTAAACAAGAGGG - Intergenic
1164806951 19:31124306-31124328 ATTTATTTATTTAGTAAAGACGG - Intergenic
1164933363 19:32192297-32192319 ATTTATTTATTTATTTAAGATGG - Intergenic
1164968150 19:32505102-32505124 ATTTATTTATTTATTTAAGATGG - Intergenic
1165604638 19:37091195-37091217 ATTCAGTTAATTACTTAAAAAGG - Intronic
1165808236 19:38595283-38595305 ATTTATTTATTTATTTAAGACGG - Intronic
1167064186 19:47171922-47171944 ATGCATTTATTTTTTTGAGACGG + Intronic
1168532345 19:57139718-57139740 ATGTATTTATTTATTTGAGATGG - Intronic
926916020 2:17893176-17893198 ATGCAGGTTTTCAGTTAAGTGGG + Intronic
927647873 2:24889830-24889852 ATTCATTTATTTATTTGAGACGG - Intronic
928516514 2:32049643-32049665 ATGTATTTATTTATTTGAGAGGG + Intergenic
928635331 2:33239897-33239919 ATTTATTTATTTATTTAAGATGG - Intronic
928769862 2:34693734-34693756 ATACATGTATTTAGTTAACATGG + Intergenic
930547578 2:52788826-52788848 ATGTATTTATTTATTTGAGATGG + Intergenic
931428697 2:62193431-62193453 ATGCCCTTATTTATTTGAGACGG + Intergenic
932482397 2:72053392-72053414 ATTCATTTATTTAGTTAAGTAGG + Intergenic
933506087 2:83178595-83178617 ATTCATTTATTTATTTAAGATGG - Intergenic
933512852 2:83263087-83263109 ATGCTATTATATAGTAAAGAAGG + Intergenic
934747323 2:96767897-96767919 TTGCATTTTTTTAGTAAAGATGG - Intronic
935164937 2:100562353-100562375 ATTTATTTATTTATTTAAGACGG + Intergenic
936107811 2:109640445-109640467 ATTTATTTATTTATTTAAGATGG - Intergenic
937023845 2:118681407-118681429 ATTTATTTATTTATTTAAGATGG + Intergenic
937547889 2:123046970-123046992 ATGCAGTTATTTACTTCTTATGG - Intergenic
937918852 2:127115818-127115840 AAGCAGTGATTTATTAAAGAAGG - Intergenic
937971568 2:127552942-127552964 ATGCAGTTAGTAAGCAAAGAAGG - Intronic
938368224 2:130752071-130752093 ATTTATTTATTTATTTAAGATGG - Intergenic
938902535 2:135810029-135810051 ATGGATTTATTTAATTGAGATGG + Intronic
939403833 2:141730722-141730744 ATGCAGTTTTTTGATTCAGAAGG + Intronic
939755733 2:146106985-146107007 AAGCAGTTAATTAGATAAGCTGG + Intergenic
940238322 2:151535054-151535076 ATGAATTTATTTAGTTGGGATGG - Intronic
942634738 2:177990987-177991009 ATTTATTTATTTATTTAAGATGG - Intronic
942807169 2:179945463-179945485 CTGTAGTTATTTCGTTCAGAAGG + Exonic
943329370 2:186540479-186540501 AAGAAGTTATTTAGAAAAGAAGG - Intergenic
943801063 2:192058069-192058091 AAAGAGTTATTTAGTTAAAAGGG + Intronic
944560181 2:200928349-200928371 ATTTATTTATTTATTTAAGATGG - Intronic
944968430 2:204962645-204962667 CTGAAGTAATTTAGTTAACAAGG + Intronic
945278826 2:208016187-208016209 ATGTATTTATTTATTTGAGATGG - Intronic
945334282 2:208573036-208573058 ATGCACATATATAGTGAAGATGG + Intronic
945714604 2:213342779-213342801 AGGCAGTTTTTTTTTTAAGATGG + Intronic
947978455 2:234387494-234387516 ATTTATTTATTTATTTAAGATGG + Intergenic
948779901 2:240312662-240312684 ATTTATTTATTTATTTAAGATGG + Intergenic
1168748546 20:265837-265859 ATTTATTTATTTATTTAAGATGG - Intergenic
1169641746 20:7759919-7759941 TTTCAGTTATTTAGTTGAGTTGG - Intergenic
1169819444 20:9692586-9692608 ATTCATTTAATTAGTTTAGAGGG + Intronic
1169856291 20:10106924-10106946 ATCCAGTTTTATAGTTCAGACGG - Intergenic
1170298670 20:14857772-14857794 GTGGAGTTATTTAGTCAATAGGG + Intronic
1173745122 20:45430662-45430684 ATTTATTTATTTATTTAAGATGG + Intergenic
1173988256 20:47279484-47279506 ATTTATTTATTTATTTAAGAGGG - Intronic
1174460605 20:50679782-50679804 TTGCAGTTTTTTAGTAGAGACGG - Intronic
1174599432 20:51712515-51712537 ATGCAGTTATTTATCTAAATCGG + Intronic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1174728855 20:52894443-52894465 ATGCAGTTACTCAGGAAAGAAGG + Intergenic
1174817967 20:53702952-53702974 ATGTATTTATTTATTTGAGACGG + Intergenic
1174883475 20:54306214-54306236 ATTCATTTATATAATTAAGAAGG + Intergenic
1175286821 20:57842168-57842190 ATTTATTTATTTATTTAAGATGG + Intergenic
1176290376 21:5040936-5040958 ATGTATTTATTTATTTGAGACGG - Intergenic
1177338794 21:19769736-19769758 ATTCATTTATTTATTTGAGACGG - Intergenic
1177850047 21:26334972-26334994 ATTTATTTATTTATTTAAGATGG + Intergenic
1178500446 21:33121795-33121817 AGGCAGTTATTTAAACAAGACGG + Intergenic
1179437509 21:41372301-41372323 ATGGAGTAATTTAGCTAGGAAGG + Intronic
1179866879 21:44222705-44222727 ATGTATTTATTTATTTGAGACGG + Intergenic
1180767946 22:18357563-18357585 ATTAATTTATTTAGTTGAGATGG - Intergenic
1180823776 22:18849357-18849379 ATTAATTTATTTAGTTGAGATGG + Intronic
1181188960 22:21125190-21125212 ATTAATTTATTTAGTTGAGATGG - Intergenic
1181210241 22:21285303-21285325 ATTAATTTATTTAGTTGAGATGG + Intergenic
1181399284 22:22641676-22641698 ATTTATTTATTTATTTAAGATGG - Intergenic
1181707242 22:24656353-24656375 ATTTATTTATTTATTTAAGATGG - Intergenic
1181737977 22:24896970-24896992 ATGTATTTATTTATTTAAGATGG - Intronic
1184001969 22:41681609-41681631 ATGCCATTAATTAGTTAATAAGG - Intronic
1184930470 22:47677444-47677466 ATTTATTTATTTATTTAAGATGG + Intergenic
1185238894 22:49730331-49730353 ATTTATTTATTTATTTAAGATGG - Intergenic
1203216708 22_KI270731v1_random:10128-10150 ATTAATTTATTTAGTTGAGATGG - Intergenic
1203273919 22_KI270734v1_random:75261-75283 ATTAATTTATTTAGTTGAGATGG + Intergenic
949369192 3:3316673-3316695 ATGAAGTGAGTTAGATAAGAAGG - Intergenic
949655095 3:6208687-6208709 ATTCAGTTTTATAGTAAAGATGG - Intergenic
949991947 3:9586714-9586736 ATATATTTATTTATTTAAGATGG + Intergenic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
951104796 3:18730243-18730265 CTCCAGTTATTTAGCTAAGTAGG - Intergenic
952462455 3:33542887-33542909 AAGCAGTAATTTATTTAAAAAGG + Intronic
953740098 3:45530512-45530534 ATGCAGTTTTTTTTTTGAGACGG - Intronic
955686341 3:61552760-61552782 ATTTACTTATTTATTTAAGATGG + Intergenic
955700309 3:61676011-61676033 GTCCAGTCATTTATTTAAGAAGG + Intronic
956064726 3:65385412-65385434 ATCCAGTTAATTAAATAAGAAGG - Intronic
956465293 3:69514681-69514703 ATTTATTTATTTATTTAAGATGG - Intronic
956515768 3:70046268-70046290 ATGAAAATATTTAGTTAAAAAGG + Intergenic
957141899 3:76370483-76370505 ATCCACTAATTTAGTTAAGCAGG - Intronic
957212987 3:77284928-77284950 GTGTAATTATTTAGCTAAGAGGG + Intronic
957350923 3:79020687-79020709 ATTTATTTATTTATTTAAGACGG - Intronic
957966720 3:87331275-87331297 TTGCACTTATCTAGTTAAGCAGG - Intergenic
957968848 3:87357560-87357582 TTACAGTTATTTTGTTAACAGGG - Intergenic
957983235 3:87538867-87538889 ATTTATTTATTTATTTAAGATGG - Intergenic
958267444 3:91455878-91455900 ACGCTGTGATTTAGTCAAGATGG - Intergenic
958649538 3:96920748-96920770 ATGGAGTTATTTAAATAAGTGGG - Intronic
958663265 3:97100616-97100638 ATGGAGTTAGTAAGTTAAGTAGG + Intronic
959397929 3:105865058-105865080 TTGCAGTTATTTTTTTAAAAAGG + Intronic
960544539 3:118898428-118898450 AAGCAGATATTTATTGAAGAGGG + Intergenic
960608378 3:119531661-119531683 ATTTATTTATTTATTTAAGACGG + Intronic
960683309 3:120272094-120272116 ATGAGGATAATTAGTTAAGAAGG - Intronic
960785958 3:121373038-121373060 ATAAAATTATTTGGTTAAGAAGG - Intronic
961241313 3:125414168-125414190 ATTCATTTATTTATTTGAGATGG - Intergenic
961720999 3:128895937-128895959 ATGCAGATGTTTAGTGAAGAGGG + Intronic
961783193 3:129333659-129333681 ATTTATTTATTTATTTAAGACGG - Intergenic
961839035 3:129692845-129692867 ATTTATTTATTTATTTAAGATGG + Intronic
962189047 3:133291038-133291060 ATGGAGATATTTTGTGAAGATGG + Intronic
963635077 3:147784652-147784674 ATTTATTTATTTACTTAAGATGG + Intergenic
963738338 3:149047635-149047657 ATGTATTTATTTATTTGAGATGG - Intronic
963909842 3:150807465-150807487 ATTTAGTTATTTATTTTAGATGG + Intergenic
964104738 3:153027084-153027106 ATTCATTTATTTATTTGAGACGG - Intergenic
964316861 3:155454476-155454498 ATTTATTTATTTATTTAAGATGG - Intronic
964440604 3:156704840-156704862 AGGCAGTTATTTTGCAAAGAAGG + Exonic
965792975 3:172409537-172409559 ATTTATTTATTTATTTAAGATGG - Intergenic
966205865 3:177405854-177405876 ATGCAATTATTTATTACAGAAGG - Intergenic
966879061 3:184339462-184339484 ATGTATTTATTTATTTGAGACGG + Intronic
967597442 3:191343639-191343661 ATGCAGTTGTTTTTTAAAGAAGG + Intronic
967868333 3:194208439-194208461 ATTTATTTATTTATTTAAGACGG - Intergenic
968226064 3:196973166-196973188 ATTTATTTATTTATTTAAGATGG + Intergenic
968309564 3:197672426-197672448 ACCCAGTTATTTATTCAAGAGGG - Intronic
969143672 4:5101521-5101543 ATGCTGTTATTTTTTCAAGAAGG + Intronic
971203234 4:24532847-24532869 ATGCAGGTATGTAGATAATATGG - Exonic
971720703 4:30242089-30242111 ATGCATTTATATAGTTTTGAAGG + Intergenic
972015960 4:34246385-34246407 CTGAAGGTATTTATTTAAGAAGG - Intergenic
972035061 4:34509486-34509508 ATGCAGACATATAGTTTAGAAGG - Intergenic
972572250 4:40321167-40321189 ATTTATTTATTTATTTAAGACGG - Intergenic
972604046 4:40597575-40597597 ATTCATTTATTTATTTGAGATGG - Intronic
972837252 4:42887384-42887406 TAGCTATTATTTAGTTAAGAAGG + Intergenic
972909216 4:43793677-43793699 AAGTAGAGATTTAGTTAAGAAGG - Intergenic
974720606 4:65733247-65733269 ATACAGTTAATAAGTTAAAAAGG - Intergenic
975023208 4:69516609-69516631 ATGTATTTATTTATTTAAGACGG + Intronic
976400563 4:84601906-84601928 ATGTATTTATTTATTTGAGATGG - Intronic
976952096 4:90846269-90846291 ATGCATTTCTTTCTTTAAGATGG - Intronic
979902403 4:126238825-126238847 TTGCAGTAATTTAGTAAATATGG - Intergenic
980394623 4:132194314-132194336 TTGAAGTTTTTTAGTAAAGAAGG - Intergenic
981137564 4:141229123-141229145 ATGCAAATATATAGATAAGAAGG + Intronic
982103068 4:151987613-151987635 ATGCAGTGATCTAGGAAAGAAGG - Intergenic
982436420 4:155386284-155386306 ATGCAGTAATTATGTTAATATGG + Intergenic
983080566 4:163380461-163380483 ATGAAGCTATTTAGATAAGATGG - Intergenic
983139535 4:164132536-164132558 ATGCAGTTATTTAGTTAAGATGG + Intronic
983195622 4:164803223-164803245 ATGCAGTAATATATGTAAGATGG - Intergenic
983229786 4:165117355-165117377 ATTTATTTATTTATTTAAGAGGG - Intronic
983260892 4:165455430-165455452 GTGCATTTATTTACTGAAGAGGG - Intronic
984795425 4:183655958-183655980 ATTCAGTTCTTTATTTCAGATGG - Exonic
985134499 4:186772192-186772214 ACGCAGTTGTTTAAATAAGACGG - Intergenic
985275684 4:188235155-188235177 ATGTATTTATTTATTTGAGATGG - Intergenic
986660449 5:10054932-10054954 ATTTATTTATTTATTTAAGATGG - Intergenic
986875596 5:12104180-12104202 ATGTTGTTTTTTAGTTAAGTAGG + Intergenic
987338431 5:16918044-16918066 AGGCTGTGATTTAGTTAAGGTGG - Intronic
988392740 5:30657124-30657146 ATGAGGTTATTTATTTAAAATGG - Intergenic
988397429 5:30712489-30712511 ATGCAGTCATTAAGTGATGAAGG + Intergenic
989313669 5:40051725-40051747 ATCCAGATATTTAGTTAACTTGG - Intergenic
989559298 5:42832571-42832593 ATTTATTTATTTATTTAAGATGG - Intronic
990626475 5:57618335-57618357 ATGCAGTACATTAATTAAGATGG + Intergenic
990920409 5:60959098-60959120 ATGCAGTTAAGTAGTTATTAAGG + Intronic
991060527 5:62370296-62370318 ATTTATTTATTTATTTAAGATGG + Intronic
992198022 5:74358638-74358660 CTTCAGTTATTTACTTAAGTTGG - Intergenic
992216369 5:74528482-74528504 ATGCAGTAATCTAGGCAAGAAGG - Intergenic
992304564 5:75422779-75422801 AAGCAGTAATTAAGTTAACATGG + Intronic
992488523 5:77218537-77218559 CTGCAGTTATTTAGAGCAGAAGG + Intronic
992680753 5:79150633-79150655 ATGTATTTATTCATTTAAGATGG + Intronic
992925556 5:81582133-81582155 ATGCTTTTATTTTGTAAAGATGG - Intronic
993715502 5:91271867-91271889 ATTTATTTATTTATTTAAGATGG - Intergenic
993993045 5:94684095-94684117 ATGGAGTTATTTATCTAATAAGG - Intronic
995090181 5:108165615-108165637 ATGCAGCTAGTTAGTGATGAAGG - Intronic
996282873 5:121753216-121753238 AAGCAGTTATTTGATTAAGCTGG + Intergenic
996829555 5:127724940-127724962 ATGGATTTCTTTAGTTGAGATGG - Intergenic
996841043 5:127847816-127847838 ATTTATTTATTTATTTAAGATGG - Intergenic
996885637 5:128350773-128350795 ACGCAGTTCCTTAGTGAAGAAGG - Intronic
997083871 5:130773412-130773434 AAGAAGTGAGTTAGTTAAGATGG - Intergenic
997757953 5:136418010-136418032 ATGCAGTGATTTATTTGAGTGGG + Intergenic
998544242 5:143012656-143012678 TTTCATTTATTTATTTAAGACGG + Intronic
1001618097 5:173057952-173057974 AGGAAGTTATTTAGTTTCGAAGG + Intronic
1002178011 5:177413281-177413303 ATTTAGTTATTTATTTGAGATGG + Intronic
1002624133 5:180512898-180512920 ATTTATTTATTTATTTAAGATGG + Intronic
1004333994 6:14747493-14747515 ATGTATTTATTTATTTGAGACGG + Intergenic
1006148679 6:31974545-31974567 TCTCAGTTATTTAGTAAAGATGG - Intronic
1009317499 6:62239566-62239588 ATTCATTTATTTAATTGAGATGG - Intronic
1009600250 6:65788613-65788635 ATGCAATATTTTAGTTGAGAAGG + Intergenic
1009638014 6:66291898-66291920 AAACAGTTATTTAAATAAGATGG + Intergenic
1009884022 6:69603093-69603115 ATGCAATTATTTAATTTAGGTGG + Intergenic
1010218516 6:73427302-73427324 ATTTATTTATTTATTTAAGATGG + Intronic
1012905669 6:105062104-105062126 ATGTATTTATTTATTTTAGACGG + Intronic
1013825784 6:114209661-114209683 ATGCAATTATTAATTTAAGTTGG + Intronic
1014194692 6:118540749-118540771 ATTTATTTATTTATTTAAGATGG - Intronic
1014194914 6:118544181-118544203 ATGCTGTTACATTGTTAAGAAGG - Intronic
1014706205 6:124750675-124750697 ATACAGTTATTCAGTGAACAAGG - Intronic
1015137937 6:129894883-129894905 ATGCATTTATTTATTTGAGATGG - Intergenic
1016061352 6:139634484-139634506 ATTCATTTATTTATTTGAGACGG - Intergenic
1016434909 6:144025886-144025908 ATTCATTTATTTATTTGAGATGG - Intronic
1016757844 6:147706396-147706418 TTGTAGTTTTTTAGTAAAGATGG + Intronic
1017109224 6:150916698-150916720 ATGCAATTTTTTAGTTTTGATGG + Intronic
1017646713 6:156545945-156545967 ATCCATTTAGTTTGTTAAGAGGG + Intergenic
1018566435 6:165159581-165159603 ATGTAGTTTTTTTGATAAGAAGG - Intergenic
1019963260 7:4478885-4478907 ATTTATTTATTTATTTAAGATGG - Intergenic
1020496022 7:8854184-8854206 ATGCAGTTATTTTGGGTAGAAGG + Intergenic
1021050561 7:15979485-15979507 ATTTATTTATTTATTTAAGACGG + Intergenic
1021095883 7:16535653-16535675 ATTCAGTCATTTGGTTAAGAGGG - Intronic
1021847188 7:24774535-24774557 ATATATTTATTTATTTAAGATGG + Intergenic
1023306164 7:38830167-38830189 ATGCAGTTATATAGTAAGCAAGG + Intronic
1023419136 7:39960573-39960595 ATTAATTTATTTATTTAAGATGG + Intronic
1025085495 7:56020044-56020066 TTGCATTTTTTTAGTAAAGATGG - Intronic
1027292195 7:76726259-76726281 ATGCAGTTATTTATACAGGAAGG - Intergenic
1027918743 7:84362100-84362122 ATCCAATTATTTAGTCATGAAGG - Intronic
1028611116 7:92712876-92712898 ATGTATTTATTTATTTGAGATGG + Intronic
1028949960 7:96623352-96623374 ATGCAGTTATGCAATTATGAAGG - Intronic
1029003506 7:97182261-97182283 AGACAGTTAGTTAGTTAGGAAGG + Intergenic
1029063618 7:97825403-97825425 ATTCATTTATTTTTTTAAGATGG - Intergenic
1029205318 7:98866305-98866327 ATGTATTTATTTATTTGAGATGG - Intronic
1029292416 7:99512295-99512317 ATGCAGTTACTTAATAAACATGG - Intronic
1030449834 7:109694108-109694130 ATACACTTATTTAGTAAAAAAGG - Intergenic
1030560465 7:111078733-111078755 ATTTATTTATTTATTTAAGATGG + Intronic
1030818301 7:114063990-114064012 ATTTATTTATTTATTTAAGATGG - Intronic
1031032833 7:116753156-116753178 TTGCAATTATTTACTTAGGAAGG + Intronic
1031210297 7:118816092-118816114 ATGCAATTATCTAGTTCAAAAGG + Intergenic
1031610260 7:123817880-123817902 ATGTATTTATTTATTTGAGATGG + Intergenic
1034027160 7:147718013-147718035 AAGGAGTTATTTAGTTACAAGGG - Intronic
1034917270 7:155051134-155051156 ATTCAGTTATTTATTGATGAAGG + Intergenic
1036415558 8:8544492-8544514 ATGCAGGTGTTTATTTCAGAAGG - Intergenic
1036969383 8:13337807-13337829 ATTCAATTATTTAGTTAATATGG - Intronic
1038100518 8:24368989-24369011 ATGAAGTCATTTTGTGAAGAAGG - Intergenic
1038272171 8:26084083-26084105 ATGCAGATATCTATTTAAGAGGG + Intergenic
1038905254 8:31894982-31895004 ATACATTTATTTAGTTAATGTGG + Intronic
1039464227 8:37772177-37772199 CTGCAGTTTTTTAGTAGAGATGG + Intronic
1039617022 8:38963917-38963939 ATTTAGTAATTTAGTGAAGACGG - Intronic
1039894530 8:41707093-41707115 ATTTATTTATTTATTTAAGATGG - Intronic
1040507945 8:48068580-48068602 ATTTATTTATTTATTTAAGATGG + Intergenic
1040716016 8:50253417-50253439 ATTTATTTATTTATTTAAGACGG - Intronic
1042211743 8:66387891-66387913 ATGCAGTAATTTAGTTGCCATGG + Intergenic
1042464441 8:69111067-69111089 ATGTATTTATTTTTTTAAGACGG - Intergenic
1042815179 8:72870302-72870324 GTGCACTTATTTTGTTAAGAGGG + Intronic
1043862116 8:85331459-85331481 ATTTATTTATTTATTTAAGATGG + Intronic
1043931381 8:86095165-86095187 ATTTATTTATTTATTTAAGAAGG - Intronic
1043981006 8:86639329-86639351 ATGCAAATATTTAGTTCAAAAGG - Intronic
1044050551 8:87497550-87497572 GTTGTGTTATTTAGTTAAGAGGG - Intronic
1044136510 8:88592542-88592564 ATTTATTTATTTATTTAAGATGG + Intergenic
1044434437 8:92145577-92145599 ATGCAGTTACTTTTTTAAAAGGG - Intergenic
1045175525 8:99720047-99720069 ATGAATTAATTTAGCTAAGAGGG - Intronic
1047085490 8:121511079-121511101 ATTTATTTATTTATTTAAGACGG - Intergenic
1047099971 8:121666157-121666179 ATGCAGTGCATTAGTTAATATGG + Intergenic
1047278044 8:123420793-123420815 ATTTATTTATTTATTTAAGACGG + Intronic
1048143477 8:131818596-131818618 CTGCAGTTATTCAGTTGAAAGGG + Intergenic
1048742488 8:137577255-137577277 ATGAAGATATTTATTTATGATGG + Intergenic
1051736598 9:20206241-20206263 ACACAGTTATGTAGTTAAAATGG - Intergenic
1053710831 9:40805914-40805936 ATTTATTTATTTATTTAAGACGG - Intergenic
1054420742 9:64926711-64926733 ATTTATTTATTTATTTAAGACGG - Intergenic
1055265851 9:74496050-74496072 TGGCAGTTATTTAGTTAATTAGG - Intergenic
1055984660 9:82045145-82045167 ATTTATTTATTTATTTAAGATGG + Intergenic
1055999874 9:82203574-82203596 ATGCAATTCTTTAGTAAAGTAGG - Intergenic
1058137007 9:101318158-101318180 ATTTATTTATTTAGTAAAGATGG - Intronic
1058335549 9:103823846-103823868 ATGCAGTTATTTGGGAAAAATGG + Intergenic
1059141402 9:111856540-111856562 ATTTATTTATTTATTTAAGACGG + Intergenic
1059648385 9:116290387-116290409 AATCAGTTATTCAGTTAAGAGGG - Intronic
1060347634 9:122830611-122830633 ATTTATTTATTTATTTAAGACGG + Intergenic
1060717110 9:125942686-125942708 AGGCAGCTATTTTGTTAAAACGG + Intronic
1061313806 9:129781433-129781455 ATTTATTTATTTATTTAAGACGG + Intergenic
1061336512 9:129941382-129941404 ATTTATTTATTTATTTAAGATGG - Intronic
1061737743 9:132673205-132673227 ATGCAGTTATACAGGTATGAAGG + Intronic
1185499936 X:588945-588967 ATTTATTTATTTATTTAAGATGG - Intergenic
1185579955 X:1204230-1204252 ATGAATTTATTTATTTGAGATGG + Intronic
1186096907 X:6112077-6112099 ATGCAGTTATTTTATCTAGAAGG - Intronic
1187771046 X:22696360-22696382 ATGCAGATATTTAGATGAGGTGG - Intergenic
1187791386 X:22953881-22953903 ATGCATACATTTAGTGAAGATGG - Intergenic
1188193908 X:27207230-27207252 AAGAAGTTATTTTCTTAAGATGG - Intergenic
1188930342 X:36101621-36101643 ATACATTTCTTTAGTTAAGGGGG + Intronic
1190251211 X:48727326-48727348 ATTTATTTATTTATTTAAGATGG - Intergenic
1192832040 X:74760870-74760892 ATTTATTTATTTATTTAAGATGG + Intronic
1195217831 X:102717834-102717856 ATTCTGTTCTTGAGTTAAGAAGG + Intergenic
1195952135 X:110286271-110286293 ATGCAGTTCTTTAGTCATGCTGG - Intronic
1196550786 X:117021980-117022002 ATTTATTTATTTATTTAAGATGG - Intergenic
1196748432 X:119092754-119092776 ATTTATTTATTTATTTAAGACGG - Intronic
1196859344 X:120012954-120012976 ATTCAGTCATTTAGCTAAGAAGG + Intergenic
1197254079 X:124244379-124244401 ATGTATTTATTTATTTGAGATGG + Intronic
1198400508 X:136263989-136264011 ATGTATTTATTTTGTTGAGACGG + Intergenic
1198960882 X:142182031-142182053 ATTTATTTATTTATTTAAGATGG + Intergenic
1200694114 Y:6342228-6342250 ATGCTGTAATTTAGTTATGATGG + Intergenic
1201041163 Y:9832491-9832513 ATGCTGTAATTTAGTTATGATGG - Intergenic
1201240386 Y:11952942-11952964 ATTTATTTATTTATTTAAGATGG - Intergenic
1201283756 Y:12362105-12362127 ATGTCTTAATTTAGTTAAGAAGG + Intergenic
1201366589 Y:13213119-13213141 ATTTATTTATTTATTTAAGATGG - Intergenic
1201604586 Y:15771167-15771189 AGGCAGTTTTTTATTTCAGATGG + Intergenic