ID: 983141521

View in Genome Browser
Species Human (GRCh38)
Location 4:164155201-164155223
Sequence CTGTGGGTATCCAGGCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 2, 2: 28, 3: 77, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983141516_983141521 -6 Left 983141516 4:164155184-164155206 CCTGTTCTTACTTGGGTCTGTGG 0: 1
1: 2
2: 8
3: 61
4: 286
Right 983141521 4:164155201-164155223 CTGTGGGTATCCAGGCTTAAGGG 0: 1
1: 2
2: 28
3: 77
4: 205
983141513_983141521 30 Left 983141513 4:164155148-164155170 CCAAAAGGCAACTTTTTGGCTGC 0: 1
1: 17
2: 42
3: 74
4: 215
Right 983141521 4:164155201-164155223 CTGTGGGTATCCAGGCTTAAGGG 0: 1
1: 2
2: 28
3: 77
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983141521 Original CRISPR CTGTGGGTATCCAGGCTTAA GGG Intronic
900751549 1:4401029-4401051 CTGTGGCTCTTCAGGCTTGAGGG + Intergenic
900892276 1:5458109-5458131 CTGTGGGTATACAGATTTTAAGG + Intergenic
901225834 1:7612546-7612568 CTGCAGGTTTCCAGGCTTGAGGG + Intronic
901242457 1:7703529-7703551 CATTGGGTGTACAGGCTTAAGGG + Intronic
903268178 1:22171170-22171192 CGGTGGGTAGCCAGGGTTTAGGG - Intergenic
904907126 1:33906073-33906095 ATGTGGGTACCCAGGCTCGAGGG - Intronic
905437570 1:37967949-37967971 CCCTGTGTATCCAGGGTTAAAGG - Intronic
905547478 1:38811282-38811304 ATGAGGGTCTCCAGGGTTAAGGG - Intergenic
905830143 1:41059229-41059251 CTGTGGGTTTCCAGGCTTGGGGG - Intronic
906860452 1:49353605-49353627 CCATGGGTTTCCAGGCTTGAAGG - Intronic
908731050 1:67226683-67226705 CTATGGGTTTCCAAGCTTGAGGG + Intronic
908851824 1:68384610-68384632 TTGGGAGTCTCCAGGCTTAAAGG + Intergenic
908896731 1:68909663-68909685 CTGTGTGTTTCCAGGGTTGAGGG - Intergenic
909045741 1:70706956-70706978 CCACGGGTATCCAGGCTTGAGGG + Intergenic
909084872 1:71158418-71158440 CTGCAGGTATCCAGGCTTGAGGG + Intergenic
909365466 1:74815457-74815479 CTGTGGTTATAAAGTCTTAAGGG - Intergenic
909837552 1:80276301-80276323 CTGTGGGTTTCCGGGCTTGAGGG - Intergenic
911335481 1:96575450-96575472 CCATGGGTTTCCAGGCTTGAGGG + Intergenic
915319667 1:155049715-155049737 CTGGGGGTATCCAGGCCCTAGGG - Intronic
915931902 1:160065915-160065937 CTGTGGGCATCCAGGCTGATGGG + Intronic
916167782 1:161978811-161978833 CTGTGTGTCTTCAGGCTTGAGGG + Intergenic
916384204 1:164249453-164249475 GTGTGGGTTTCCAGACTTGAGGG - Intergenic
916705214 1:167342153-167342175 CCATGGGTTTCCAGGCTTGAGGG + Intronic
916918850 1:169440087-169440109 CCGTGGGTTTCCAGGCTTGAGGG + Intronic
917087626 1:171319462-171319484 CTGTAGGTTTCCAGGCTTGAGGG + Intronic
917538192 1:175889605-175889627 CTGAGGGTAGCGAGACTTAAAGG + Intergenic
917539844 1:175901893-175901915 CTGTGGGTTTTCAGGCTTGAGGG - Intergenic
919048113 1:192480043-192480065 CTGTGGGTCTCCAGGCTTAAGGG - Intergenic
920972905 1:210757851-210757873 CTAAGGGTATCCAGGCTTTATGG - Intronic
921520877 1:216152784-216152806 CTGTGGGTTTCCAGGCTTCAGGG - Intronic
922033361 1:221825453-221825475 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
923315174 1:232773268-232773290 CCGCGGGTATCCAGGCTTGAGGG - Intergenic
1063019984 10:2117662-2117684 CTGCAGGTCTCCAGGCTTGAGGG + Intergenic
1064705552 10:18069431-18069453 CTGTGGGTCTCCAGGCTTGAGGG - Intergenic
1064709490 10:18109217-18109239 CCATGGGTCTCCAGGCTTGAGGG - Intergenic
1065009801 10:21410860-21410882 CTGTGGGCCTCCAGGCTTAAAGG + Intergenic
1065011783 10:21427512-21427534 TGGCGAGTATCCAGGCTTAAGGG + Intergenic
1066287563 10:33982779-33982801 CTGTAGGCCTCCAGGCTTGAGGG + Intergenic
1066563198 10:36692274-36692296 CCGAGGGTATCCAGGCTTGAGGG - Intergenic
1066564781 10:36710276-36710298 CTGCTGGTGTCCAGGCTTGAGGG - Intergenic
1067656103 10:48192771-48192793 TTGTTTGTATCCAGGCTTCAGGG - Exonic
1068907020 10:62338231-62338253 CTGTGTGTTTCCAGGCTTGAGGG - Intergenic
1071129085 10:82370547-82370569 ATGCGGGCATCTAGGCTTAAAGG + Intronic
1071490082 10:86130357-86130379 CTGTGAGTTTCCAGGCTTGAGGG - Intronic
1072392884 10:95006866-95006888 CTGTGTTTATACAGGCATAATGG - Intergenic
1075336488 10:121612637-121612659 CTGTGGGAATCCAAGTTTGAGGG - Intergenic
1075848614 10:125567776-125567798 CCGTGGGTTTCCAGGCTTGGGGG - Intergenic
1076035755 10:127196985-127197007 CTTTGGGAAGCCAGGCTTGAAGG + Intronic
1076102464 10:127794114-127794136 CTGTGGGTTTGCAGACTTGAGGG - Intergenic
1076561207 10:131365777-131365799 CTGTGTGATTCCAGGCTTATGGG - Intergenic
1077712395 11:4550565-4550587 CCGTGGGTTTCCAGGCTTTGAGG - Intergenic
1077714604 11:4569018-4569040 CTGTGGGTTTCCAGGCTTGAGGG - Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1080302090 11:30796014-30796036 CTGTGTATATCCAGTCTCAAAGG + Intergenic
1080654774 11:34250189-34250211 CTGAGGGTATCTAGGCATTAAGG + Intronic
1080723781 11:34874793-34874815 CCATGGGTTTCCAGGCTTGAGGG - Intronic
1081992576 11:47345760-47345782 GTGTGGCTCTCCAGGCTTAGCGG + Intronic
1082075710 11:47974640-47974662 CTGAGGGTTGCCAGGCTGAATGG + Intergenic
1082751472 11:57022802-57022824 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1083747946 11:64745531-64745553 CTGTGGGGAGCCAGGCTTCCGGG - Intergenic
1088748493 11:112824281-112824303 CCTTGGGTTTCCAGGCTTGAAGG - Intergenic
1090540772 11:127700624-127700646 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1090554175 11:127855881-127855903 CCATGGGTTTCCAGGCTTAAGGG + Intergenic
1093749288 12:22779839-22779861 CTGTGGGTTTCCAGGCTTGAGGG + Intergenic
1094474928 12:30833588-30833610 CTGTGGGCTTCCAGGCTTGGGGG - Intergenic
1094745654 12:33341508-33341530 GTGTGGGTTTCCAGGTTTGAGGG + Intergenic
1097059102 12:56269138-56269160 CTGGTGGTATCCAGCCGTAAGGG + Exonic
1097265067 12:57739734-57739756 CTGTGGGTAGCCAGGTGTCAGGG - Intronic
1098757747 12:74387559-74387581 CTGCAGGTTTCCAGGCTTGAGGG + Intergenic
1098758377 12:74391950-74391972 CTGTAGGTTTCCAGGCTTGAGGG + Intergenic
1100386961 12:94112634-94112656 CTGTGAGTCTCCAGGCTTGAGGG - Intergenic
1100759854 12:97795415-97795437 CTGTGGGTTTCCAGGCTAATTGG - Intergenic
1104096858 12:125565885-125565907 CTGTGTGTTTCCAGGCTTGAGGG + Intronic
1106800818 13:33254531-33254553 CTGTGGGTCTTCAGGCTTGATGG - Intronic
1106823240 13:33490313-33490335 CCATGAGTATCCAGGCTTGAGGG - Intergenic
1108159012 13:47618620-47618642 CTGTAGATTTCCAGGCTTGAAGG - Intergenic
1108933414 13:55860180-55860202 CTGTGGGAGTTCAGGATTAAGGG + Intergenic
1108983700 13:56555887-56555909 CTGTGGGTATCCAGAAGTAGTGG - Intergenic
1109204498 13:59466678-59466700 TTGTGTGTTTCCAGGCTTGAAGG - Intergenic
1109801044 13:67379611-67379633 CAGCAGGTATCCAGGCTTGAGGG - Intergenic
1109958630 13:69602697-69602719 CTGTGGATATCCAAGCTTGAAGG - Intergenic
1111206753 13:85020637-85020659 CTGTGGGCAGCTAGGCTGAAAGG + Intergenic
1111668124 13:91295647-91295669 CTGTGGGTATCCAGGCCTGAGGG - Intergenic
1112067371 13:95807969-95807991 CTTTGTGTAACAAGGCTTAAAGG + Intronic
1112259721 13:97867416-97867438 TTGTGGGTCTCCAGGCTTGAGGG - Intergenic
1113062015 13:106331968-106331990 CCGTGGGTCTCCAGGCTTGAGGG + Intergenic
1113288282 13:108878176-108878198 CTGTGGGTTACCAGGCTTGAGGG - Intronic
1116253381 14:42516554-42516576 CCATGGGTATCCAGGCTTGAGGG + Intergenic
1119023861 14:71137235-71137257 CCATGGGTATCCAGGCTTGAAGG + Intergenic
1119223580 14:72927663-72927685 CTGTGGGTAACCAGGCCTGGGGG + Intronic
1120280511 14:82432050-82432072 TCGTGGGTCTCCAGGCTTGAGGG + Intergenic
1120685310 14:87530824-87530846 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
1121172763 14:91868451-91868473 CCATGGGTACCCAGGCTTGAGGG + Intergenic
1127863942 15:63016543-63016565 CTGTGGCCAGGCAGGCTTAAAGG + Intergenic
1129242726 15:74261225-74261247 CTGTGGGTAACCATGCTTGCAGG - Intronic
1129562252 15:76583381-76583403 CTTTGGTTATCCATGCTTATGGG - Intronic
1130667182 15:85879662-85879684 CTGTGGGTACCCACGCTGAGAGG - Intergenic
1131365741 15:91837674-91837696 CCGTGGGTTTCCAGGCTTGAGGG + Intergenic
1131713014 15:95076021-95076043 CTGAGTATACCCAGGCTTAAAGG + Intergenic
1134347924 16:13408916-13408938 CCATGGGTATCCAGGCTTGAGGG - Intergenic
1138977871 16:62230271-62230293 CCCTGGGTATCCAGGCTTGAGGG - Intergenic
1139093808 16:63680409-63680431 CCGTGGGTCTCCAGGCTTGAAGG + Intergenic
1139295251 16:65895076-65895098 CTGTTGGCTTCCAGGCTTGAGGG - Intergenic
1140339163 16:74140074-74140096 CCATGGGTATCCAGGCTTGAGGG + Intergenic
1144371311 17:14594339-14594361 TGGTGGGTCTCCAGGCTTGAGGG - Intergenic
1145289117 17:21529323-21529345 CCATGGGTCTCCAGGCTTGAGGG - Exonic
1147875552 17:43618111-43618133 CTGTGGGTGCCCAGGCTGAGTGG + Intergenic
1149429667 17:56587623-56587645 CTGTTCCTATCTAGGCTTAAAGG - Intergenic
1150493194 17:65588428-65588450 CTGTCAGTATCCAGCCTTGAAGG - Intronic
1151196261 17:72433324-72433346 CTGTGCTTTTCTAGGCTTAACGG + Intergenic
1152028420 17:77826633-77826655 CTGGGGGAGTCCAGGCATAAAGG + Intergenic
1152453478 17:80398534-80398556 GTGTGGGTACCCTGGCTTACAGG - Exonic
1152515831 17:80824066-80824088 CTCTGGGTTTCCAGGGTTGAGGG - Intronic
1154155972 18:11944339-11944361 CTGCGGGTTTCCAGGCTCAAGGG + Intergenic
1155314575 18:24558616-24558638 CCGTGGGTATCCAGGCTTGAGGG + Intergenic
1157719581 18:49913670-49913692 CCATGGGTATCCAGGCTTGAGGG - Intronic
1158057953 18:53304234-53304256 CTGTGGGTTTCCAGGCTTGAGGG + Intronic
1159726189 18:71962791-71962813 CTGTGGGAATCAGGGCTTGAAGG + Intergenic
1160484443 18:79276233-79276255 CTGTAGGTTTCCAGGCCTACAGG + Intronic
1162131273 19:8527484-8527506 CTGTGGGGATGCAGGATTAGAGG + Intronic
1165152881 19:33771312-33771334 CTGTGGACATCCAGGCTGGAGGG - Intronic
1167098091 19:47386176-47386198 CTGTATGTATCCAGGGTTATAGG + Intergenic
1167495070 19:49812851-49812873 CTTTGGGGAACCAGGCTTATTGG + Intronic
1168374297 19:55862923-55862945 CTGTGTGTATTCAGCCTTCATGG + Intronic
926506350 2:13721228-13721250 CTGTAGGTTTCCAGGCTTGATGG - Intergenic
928103864 2:28455064-28455086 CCGTGGGTCTTCAGGCTTGAGGG - Intergenic
928698135 2:33871543-33871565 CTGTGGGTTTCCAGGCTTGTGGG - Intergenic
933409804 2:81910537-81910559 CTGTGGGCCTCCAGGCTTGATGG + Intergenic
933437295 2:82263564-82263586 CTCTGGGTTTCCAGGTTTGAGGG + Intergenic
934791847 2:97068620-97068642 CTGCGGGTTTCCAGACTTGAGGG + Intergenic
934814769 2:97315090-97315112 CTGCGGGTTTCCAGACTTGAGGG - Intergenic
934822925 2:97393393-97393415 CTGCGGGTTTCCAGACTTGAGGG + Intergenic
935894423 2:107719517-107719539 CCGCGGGTTTCCAGGCTTGAGGG - Intergenic
938550006 2:132371113-132371135 CTGTGGGTTTCCAAGTTTGAGGG + Intergenic
938699573 2:133863857-133863879 CCATGGGTTTCCAGGCTTGAGGG + Intergenic
939356955 2:141114702-141114724 CCATGGGTTTCCAGGCTTGAAGG + Intronic
939829331 2:147053637-147053659 CCGTGGGTATCCACGCTTGAGGG - Intergenic
940660059 2:156534421-156534443 CCATGGGTTTCCAGGCTTGAGGG + Intronic
941233184 2:162937967-162937989 CTGCAGGTCTTCAGGCTTAAGGG - Intergenic
942173297 2:173308089-173308111 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
946538491 2:220657856-220657878 GTGTGGGTCTTCAGGCTTGAGGG + Intergenic
946712104 2:222517198-222517220 CAGTGGGTTTCCAGGCTGGAGGG - Intronic
947129118 2:226903701-226903723 CTGTGGGTTTCCAGGCTTGAGGG - Intronic
947984556 2:234437405-234437427 CTGTGGTTATGCATGCTTGAAGG - Intergenic
1170808895 20:19658184-19658206 CTGTGGGTCTCCAGGCCCCATGG - Intronic
1170967363 20:21085952-21085974 CTGTGGGTCTTGAGGGTTAAAGG - Intergenic
1171895160 20:30751860-30751882 CCGTGGGTTTCCAGGCTTGTGGG - Intergenic
1172903360 20:38350803-38350825 CTGTGGATGTTCAGGCTGAAGGG - Exonic
1173059566 20:39648411-39648433 CTGCGGGTTTTCAGGCTTGAGGG + Intergenic
1173369876 20:42426131-42426153 CTGTGGGTTTCCAGGCTTGAGGG - Intronic
1173389923 20:42622859-42622881 CTGTGGGTTTCTTGGCTTGAAGG - Intronic
1173396976 20:42689085-42689107 CTGTGGGTCTTCAGGCTTGAGGG - Intronic
1174524520 20:51160548-51160570 CTTTGGTTAGACAGGCTTAATGG - Intergenic
1174604874 20:51754095-51754117 CTGTGGGGCTCCAGGCTCCAGGG - Intronic
1175842951 20:62042034-62042056 CTGCAGGTGTCCAGGCTTGAGGG - Intronic
1178114667 21:29404990-29405012 CTGTGGGTATCAAGGCTTGAGGG + Intronic
1178222366 21:30674868-30674890 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
1179783164 21:43715561-43715583 CCGTGGGTTTCCAGGCTTGAGGG - Intergenic
949464713 3:4332774-4332796 CCGCAGGTATCCAGGCTTGAGGG - Intronic
949802065 3:7914992-7915014 CTGCAGGTTTCCAGGCTTGAGGG - Intergenic
949808321 3:7978786-7978808 CTGCGGGTCTTCAGGCTTGAGGG + Intergenic
951162459 3:19441274-19441296 CTTTGTGTATCCAGCCCTAAGGG + Intronic
952156997 3:30654379-30654401 CTGAGGGATTCCAGGGTTAAGGG - Intronic
956181199 3:66519461-66519483 CTATGGATATTCAGGCTTGAGGG + Intergenic
956621466 3:71225239-71225261 CTGTGGCTATCCAGGCAAAGGGG - Intronic
957383603 3:79467332-79467354 CTATGGGTCTCCAGGCTTGAGGG - Intronic
957591508 3:82205209-82205231 CTGTGGGTTTCCAGGTTTGAAGG + Intergenic
957984921 3:87562188-87562210 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
958023726 3:88026570-88026592 CCTTGGGTTTCCAGGCTTGAGGG + Intergenic
958524723 3:95241092-95241114 CTGTGGGTTTTCAGGCTTGAGGG + Intergenic
959164435 3:102758990-102759012 CTGTGGGTATCCATGCTTGAGGG + Intergenic
959254697 3:103993214-103993236 CTGCGGGTATTCAGGCTTGAGGG + Intergenic
959575088 3:107925445-107925467 CCGTGGGTATCCAGGCTTGAGGG + Intergenic
959773946 3:110134587-110134609 CTGTGAGTTTCCAGGCTTGAGGG - Intergenic
959839608 3:110959133-110959155 CCATGGGTCTCCAGGCTTGAGGG + Intergenic
960359839 3:116697895-116697917 TTGTGGGTTTCCAGTCTTGAGGG + Intronic
960369001 3:116810781-116810803 CTGCAGGTTTCCAGGCTTGAAGG - Intronic
963073798 3:141328187-141328209 CTCTGTCTATCCATGCTTAAAGG + Intronic
963234761 3:142945808-142945830 CTGAGAGTCTCCAGGCTTAAGGG + Intergenic
963789439 3:149568385-149568407 GTCTGGGAATTCAGGCTTAAAGG + Intronic
967070938 3:185961718-185961740 CAGCAGGTATCCAGGCTTAAGGG + Intergenic
969976592 4:11108554-11108576 CTGTGGGTTTCCAGGCTTGGGGG + Intergenic
970046598 4:11861556-11861578 CCATGGGTATCCAGGCATGAGGG - Intergenic
970081473 4:12291953-12291975 CTGTAAGTTTCCAGGCTTGAGGG - Intergenic
970413897 4:15837631-15837653 CTGTGCTTTTCCAGGCCTAAGGG + Intronic
970720864 4:18987350-18987372 CCATGGGTCTCCAGGCTTGAGGG - Intergenic
971742732 4:30540435-30540457 CTGTGGGTTTCCAGGCTTGAGGG + Intergenic
971796872 4:31239226-31239248 CTGTGAATTTCCAGGCTTGAGGG + Intergenic
973193173 4:47409660-47409682 CTGTGGGGTTCCATGCTTGAGGG + Intronic
973221160 4:47729666-47729688 CTGTGGGTCTTCCAGCTTAAGGG - Intronic
974186572 4:58454764-58454786 CCATGGGTCTCCAGGCTTGAGGG + Intergenic
974368690 4:60985987-60986009 CGGTGGGTTTCCAGGCTTGAGGG + Intergenic
975060147 4:69986486-69986508 CTATGGGTTTCCAGGCTTGAGGG + Intergenic
976221695 4:82761532-82761554 CTGTGGGAATGGAGGCTTCAGGG - Intronic
977441152 4:97070056-97070078 TTGTGGGTTTCCAGGCTTGAGGG - Intergenic
977619457 4:99120101-99120123 CTGAGGGTCTCCAGACTTGAGGG - Intergenic
978579842 4:110220690-110220712 CTGCAGGTTTCCAGGCTTGAGGG + Intergenic
979392204 4:120140852-120140874 CCGTGAGTATCCAGGCTTGAGGG - Intergenic
980006094 4:127544270-127544292 CTGCGGTTTTCCAGGCTTGAGGG - Intergenic
980096994 4:128501620-128501642 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
980318207 4:131233993-131234015 CTGTGGGTTTCCAGGCTTGAGGG - Intergenic
980480343 4:133379660-133379682 CTGTGGGGATCCAAGCTTGAGGG - Intergenic
982124047 4:152169256-152169278 GTGTAGGTATCCCTGCTTAATGG + Intergenic
983141521 4:164155201-164155223 CTGTGGGTATCCAGGCTTAAGGG + Intronic
983781379 4:171674388-171674410 CCGCGGGTAACCAGGCTTGAGGG - Intergenic
984520576 4:180796659-180796681 CTGTGGGTATCCAGGCTTGAGGG + Intergenic
985138357 4:186812335-186812357 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
987271523 5:16314448-16314470 CCCTGGGTATCCAGGCTTGGGGG - Intergenic
989735041 5:44693856-44693878 CCATGGGTATCCAGGCTTGAGGG - Intergenic
991645041 5:68792967-68792989 CCATGGGTTTCCAGGCTTGAGGG + Intergenic
992474562 5:77088845-77088867 CCATGGGTTTCCAGGCTTGAGGG + Intergenic
992637076 5:78735470-78735492 CTGTGGGTTTTCAGGCTTGAGGG - Intronic
992992547 5:82298727-82298749 CCGTGGGTTTCCAGGCTTAAGGG + Intronic
994819250 5:104627859-104627881 CTGAGGGTTTCCAGGCTTCAGGG - Intergenic
995648809 5:114344321-114344343 CTGTGAGTATACAGTCTTCAGGG - Intergenic
996536802 5:124585821-124585843 CCATGGGTCTCCAGGCTTGAGGG + Intergenic
996648010 5:125840794-125840816 CTGTGGGTCTCCAGGCTTGGGGG - Intergenic
996710169 5:126535781-126535803 CCGTGGGTTTCCAAGCTTCAGGG + Intergenic
996852355 5:127966820-127966842 CCGCGGGTATCCAGGCTTGAGGG + Intergenic
997424966 5:133796815-133796837 CCTCGGGTATCCAGGCTTGAAGG + Intergenic
997778643 5:136634747-136634769 CTGTGGGTATTCAGGATGGAGGG + Intergenic
997945009 5:138192503-138192525 CTGCTGCTATCCAGGCTTATAGG - Exonic
999811016 5:155127099-155127121 CTGTGGGTCTTCAGGCTTGAGGG + Intergenic
999811505 5:155131623-155131645 CTGTGAGTATCCAGGCTTGAGGG + Intergenic
1003165200 6:3671374-3671396 GTTTGGGAATCCAGGCCTAAGGG + Intergenic
1003593093 6:7452444-7452466 CCATGGGTATCCAGGCTTGAGGG - Intergenic
1004469591 6:15917287-15917309 CTGTGGGTATTCAGGCTTGAGGG + Intergenic
1008099710 6:47377670-47377692 CCGTGTGTATCCAAGCTTGAGGG + Intergenic
1009404142 6:63291679-63291701 CCATGGGTTTCCAGGCTTGAGGG + Intronic
1010316002 6:74451692-74451714 CCATGGGTATCCTGGCTTGAGGG - Intergenic
1010453083 6:76025649-76025671 CTCTGGATATGCAGGCTTGAGGG - Intronic
1010634362 6:78239609-78239631 CTGTGTGTTTCCAGGCTTGAGGG - Intergenic
1011491885 6:87901035-87901057 CTGTGGGTTTCCAGGCTTGAGGG + Intergenic
1011510254 6:88093087-88093109 CTGTGGATTTCCAGGCTTGGGGG - Intergenic
1014434782 6:121409192-121409214 CAGTGGATATCTGGGCTTAAGGG - Intergenic
1014825754 6:126047188-126047210 CCGTGGGTTTTCAGGCTTGAGGG - Intergenic
1015042818 6:128742540-128742562 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
1015349049 6:132195295-132195317 CTATGGGAATCCAGGCTTGAGGG + Intergenic
1015916797 6:138225871-138225893 CTGTGAGAAGACAGGCTTAAAGG + Intronic
1016532842 6:145076833-145076855 CTGTGGGTCTCCAATCTTGAGGG + Intergenic
1018201393 6:161398911-161398933 CCATGGGTTTCCAGGCTTGAGGG - Intronic
1019045723 6:169143778-169143800 CCATGGGTCTCCAGGCTTGAGGG + Intergenic
1021041853 7:15872504-15872526 CCGTGGGTATCCAGGCTTGAGGG - Intergenic
1024173173 7:46810991-46811013 CAGCGGGTTTCCAGGCTTAAGGG + Intergenic
1027706095 7:81535594-81535616 CCGTGGGTTTCCAGGCTTGAGGG - Intergenic
1028530447 7:91832318-91832340 CCATGGGTTTCCAGGCTTGAGGG + Intronic
1028872339 7:95783091-95783113 CCGTTGGTTTCCAGGCTTGAGGG + Intronic
1029008331 7:97232784-97232806 CCATGGGGATCCAGGCTTGAGGG + Intergenic
1029016068 7:97316486-97316508 CTGTGGTTTTCCAGGCTTGAGGG - Intergenic
1029017109 7:97326094-97326116 CTGTGGGTTTCCAGGCTTGAGGG + Intergenic
1029923313 7:104289257-104289279 ATTTGGATATCCAGGCTCAATGG + Intergenic
1030117566 7:106073817-106073839 CTGCAGGTTTCCAGGCTTTAGGG - Intergenic
1030386504 7:108873943-108873965 CCGTGGGTTTCCAGGCTTGAGGG - Intergenic
1031588769 7:123565090-123565112 CTGTGGGTTTTCAGGCTTTTGGG - Intergenic
1032406210 7:131657813-131657835 CTGTCGGTCTACAGCCTTAAAGG - Intergenic
1033573256 7:142655214-142655236 CTGCAGGTCTCCAGGCTTGAGGG - Intergenic
1035239303 7:157519675-157519697 CAGTGGGAATTCAGGCTTCATGG - Intergenic
1035732663 8:1863780-1863802 CTGTGGCTCTCCAGGGTGAACGG - Intronic
1037622804 8:20580203-20580225 CTGAGGGTTTCCAGCCTTATAGG - Intergenic
1038911815 8:31973226-31973248 CTGTGGATATACAGGCTTTTGGG + Intronic
1040669459 8:49671780-49671802 AAGTGGATATACAGGCTTAAGGG + Intergenic
1041216618 8:55607569-55607591 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
1042334218 8:67613718-67613740 CCATGGGTATACAGGCTTGAGGG - Intronic
1042984323 8:74566404-74566426 CTGTGGGTCTCCAGGCTCGAGGG - Intergenic
1043701952 8:83300520-83300542 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
1043815162 8:84792568-84792590 CCACGGGTTTCCAGGCTTAAGGG + Intronic
1044022767 8:87127842-87127864 CTGTGGGTTTCCAGGATTTAAGG - Intronic
1046567206 8:115917365-115917387 CTGCGGGTTTCCAGGCTTGAGGG - Intergenic
1046582475 8:116110561-116110583 TTGTGGGTTTCCAGGCTTGAGGG - Intergenic
1047055007 8:121154032-121154054 CTATAGGTGTCCAGGCTGAATGG - Intergenic
1048195264 8:132327474-132327496 CCCTGGGTATCCAGACTTAAGGG - Intronic
1049010669 8:139884912-139884934 CAGGGGGTCTCCAGGCTGAAGGG + Intronic
1050069619 9:1796818-1796840 TTGTGGATCTCCAGGCTTACCGG - Intergenic
1050934716 9:11380479-11380501 CTGCAGGTATCCAGGCGTGAGGG + Intergenic
1051447887 9:17160778-17160800 CTCTAGGCATCCAAGCTTAAAGG - Intronic
1052113519 9:24619376-24619398 CCATGGGTTTCCAGGCTTTAGGG + Intergenic
1052201256 9:25783974-25783996 CTGTGGGTAAACACACTTAATGG - Intergenic
1052459697 9:28747029-28747051 CCCTGGGTTTCCAGGCTTGAAGG - Intergenic
1056085776 9:83148090-83148112 CTGAGGGTTTCCAGTCTTGAGGG + Intergenic
1056301841 9:85249895-85249917 CCATGGGTATCCAGGCTTGAGGG + Intergenic
1056491269 9:87109521-87109543 CTGAGGAATTCCAGGCTTAAAGG - Intergenic
1058256861 9:102777658-102777680 CCATGGGTATCCAGGCTTGAGGG - Intergenic
1059398504 9:114054007-114054029 CTGTGAGTCTCCAGGATTCAAGG + Exonic
1060076215 9:120592548-120592570 CTGCAGGTCTCCAGGCTTGAGGG + Intergenic
1060598036 9:124859780-124859802 CTGTGGGTGTCTAGGCCTCAGGG + Intronic
1062148829 9:135007103-135007125 CTGTGGGGAGCCGGGCTTAGGGG - Intergenic
1185738556 X:2512042-2512064 CTGTGGGTTTCCAGGCGTGAGGG + Intergenic
1185982941 X:4799286-4799308 CTGCAGGTATCCAGGCTTGAGGG + Intergenic
1186031698 X:5375869-5375891 CCGTGGGTTTCCAGGCTTGAGGG - Intergenic
1186185277 X:7014286-7014308 CCGCGGGTCTCCAGGCTTGAGGG + Intergenic
1188807064 X:34604692-34604714 CTGTGGGTTTCCAGGCTCGAGGG - Intergenic
1188844661 X:35058411-35058433 CTCTGGCTTTCCTGGCTTAAAGG + Intergenic
1190569311 X:51765840-51765862 CTGTGGGTTTCCAGACTTGAGGG - Intergenic
1192113857 X:68392553-68392575 CCGTGGGTCTCCAGGCTTGAGGG - Intronic
1192175717 X:68883978-68884000 CTTTGGGTAACAAGGCTTAGAGG - Intergenic
1192329836 X:70166373-70166395 CTGTGGGTCTCTGGGCTTATGGG + Intergenic
1193709327 X:84860475-84860497 CTGCAGGCTTCCAGGCTTAAGGG - Intergenic
1194752108 X:97696924-97696946 CCACGGGTATCCAGGCTTGAGGG - Intergenic
1194763119 X:97817297-97817319 CTGCAGGTATCCAGGCTTGAGGG + Intergenic
1195570541 X:106394506-106394528 CAATGGGTATGCAGGCTTCAGGG - Intergenic
1195767318 X:108309787-108309809 GTGTGTGTTTCCAGGATTAATGG - Intronic
1196375100 X:115025234-115025256 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
1197013422 X:121594331-121594353 CCATGGGTCTCCAGGCTTGAGGG + Intergenic
1197739191 X:129876313-129876335 CTGTGGATATCCAGGCTTGAGGG - Intergenic
1197843026 X:130770381-130770403 GTGTGGATTTCCATGCTTAAAGG + Intronic
1198853957 X:140996123-140996145 CCATGGGTTTCCAGGCTTGAGGG + Intergenic
1198878057 X:141248983-141249005 CCATGGGTTTCCAGGCTTGAGGG - Intergenic
1199020084 X:142868740-142868762 CTGTGGGTCTCCAGGCTTGAGGG + Intergenic
1199380605 X:147168205-147168227 CTGTGGGTTTCCAGGCTTGAGGG - Intergenic
1199575735 X:149312041-149312063 CTGCGGGTTTCCAGGCTTAAGGG + Intergenic
1200112069 X:153745417-153745439 CTGTGGCCATCCATGCATAAAGG - Intergenic
1201153758 Y:11111301-11111323 CTTTGGGTATATATGCTTAAAGG + Intergenic
1201751542 Y:17436915-17436937 CCATGGGTTTCCAGGCTTGAGGG + Intergenic