ID: 983148637

View in Genome Browser
Species Human (GRCh38)
Location 4:164248126-164248148
Sequence GATACATGGAGGAGTACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983148637 Original CRISPR GATACATGGAGGAGTACTTC AGG (reversed) Intronic
902063611 1:13665706-13665728 GAAATATGGAGGAGGCCTTCAGG - Intergenic
911841017 1:102681986-102682008 TATGCATGCAGGAGTACTTAAGG - Intergenic
917393562 1:174566372-174566394 GAAAGGTGGAGGAGAACTTCTGG + Intronic
919395038 1:197035618-197035640 GATAGATGTAGGCCTACTTCAGG - Intergenic
919432478 1:197513584-197513606 AATACATAGTGAAGTACTTCAGG - Intronic
1063984885 10:11491652-11491674 GACACAAGGAGGAGTACATCTGG + Intronic
1064994494 10:21284420-21284442 TATCAATGGAGGAGTAATTCTGG - Intergenic
1066348293 10:34611480-34611502 GACACATGCAGGAGTAATTTCGG + Intronic
1068476363 10:57531758-57531780 GCTGCATGGGGGAGAACTTCTGG - Intergenic
1069781798 10:70961548-70961570 GATCGAAGGAGGAGAACTTCAGG + Intergenic
1070999535 10:80816875-80816897 GATAAATGGAGGAGTGCTTATGG - Intergenic
1075988751 10:126814397-126814419 AAAACATGGGGGAATACTTCAGG - Intergenic
1080512529 11:32988953-32988975 TATACATGAAGGATTATTTCTGG - Intronic
1087160240 11:94941444-94941466 GACACATGGAGAAGTGCATCAGG - Intergenic
1095567151 12:43638257-43638279 GATACATACAGGCATACTTCAGG - Intergenic
1095818708 12:46453170-46453192 GACAGAGGGAGGAGTACTTGTGG - Intergenic
1096387057 12:51201177-51201199 GAAACATGGACTAGTACTGCAGG - Intronic
1096670226 12:53194070-53194092 GATGGATGGAGGACTACCTCAGG + Exonic
1098877026 12:75876557-75876579 GTTACATGGATGAGTTCTTTAGG - Intergenic
1100465787 12:94844289-94844311 AAAACATGGAGCAGTATTTCTGG - Intergenic
1101517633 12:105451560-105451582 GATACTGGGAGGAGTAGCTCAGG + Intergenic
1101656297 12:106723485-106723507 GATATATGCTGGAGTACTTCCGG - Intronic
1104337860 12:127917444-127917466 GAAATAAGGATGAGTACTTCAGG - Intergenic
1108487379 13:50940659-50940681 GACACATGGAGGCTTAGTTCAGG + Intronic
1111309263 13:86459798-86459820 GATGCATGCATGAGAACTTCGGG + Intergenic
1114253720 14:20983852-20983874 GATACATGAAGGACAAATTCTGG - Intergenic
1115278318 14:31632629-31632651 CATACATGGAAGACTACTTTGGG - Intronic
1118064903 14:62180203-62180225 GATTCATGGAGGAGAACTTTGGG + Intergenic
1123146718 14:106139486-106139508 TAGACATAGAGGAGTACTTTTGG - Intergenic
1126954376 15:53915888-53915910 GATGCATGGAAAAGTACTTGTGG + Intergenic
1135811863 16:25594589-25594611 GATACAGAGAAGAGTACTTTGGG + Intergenic
1136692353 16:32042056-32042078 TAGACATAGAGGAGTACTTTTGG + Intergenic
1136792848 16:32985290-32985312 TAGACATAGAGGAGTACTTTTGG + Intergenic
1136877007 16:33868765-33868787 TAGACATAGAGGAGTACTTTTGG - Intergenic
1138068095 16:53963227-53963249 GAAACATGGAGAATTAGTTCTGG - Intronic
1140564664 16:76027302-76027324 GAGGCTGGGAGGAGTACTTCCGG - Intergenic
1141047972 16:80734297-80734319 GCTACATGGAGTAGGACTTCGGG + Intronic
1203095106 16_KI270728v1_random:1246973-1246995 TAGACATAGAGGAGTACTTTTGG + Intergenic
1149242031 17:54662317-54662339 GAAACACAGAGGAGAACTTCAGG - Intergenic
1149534954 17:57426086-57426108 GATACATGCAGGAGAGTTTCAGG + Intronic
1155387846 18:25300076-25300098 GTTCCAAGAAGGAGTACTTCAGG - Intronic
1156855051 18:41772162-41772184 GATACATGGCTCATTACTTCAGG - Intergenic
1157307923 18:46530416-46530438 GATTCATGCAGGAGTGTTTCTGG + Intronic
1158883775 18:61806161-61806183 GATTCAAGGAGCAGTAGTTCTGG + Intergenic
1159573675 18:70149231-70149253 CATACATACAGGAGAACTTCAGG + Intronic
928968751 2:37004482-37004504 GATACATAGAGGAGGACATAGGG - Intronic
931587444 2:63843091-63843113 GATAAATGTAGGTGTACTTTTGG + Intronic
932038425 2:68272352-68272374 GACACATGGGGGTGTAGTTCAGG - Intergenic
936432283 2:112474923-112474945 GATGGAGGGAGGAGTAGTTCAGG + Intergenic
939613474 2:144336666-144336688 GATCCAGAGAGGAGTAGTTCAGG + Intergenic
941983183 2:171482808-171482830 GGTAGATGGTGGAATACTTCTGG + Exonic
1169977054 20:11341283-11341305 GAAACATGGAGCAGTACTTGTGG + Intergenic
1182454934 22:30444262-30444284 GTTACCTGCAGGAGTACTTGGGG + Intergenic
1182901458 22:33901752-33901774 GATACATGGATGACTTATTCAGG + Intronic
1183790950 22:40068814-40068836 GAGGCAGGGAGGACTACTTCAGG - Intronic
951661505 3:25071712-25071734 AATACTTGGAGGAGAAATTCCGG + Intergenic
956205483 3:66750537-66750559 GTTACATGGATGAGTTCTTTAGG - Intergenic
957203557 3:77166036-77166058 GATACATGCTGGAGTACTTATGG - Intronic
959988648 3:112605668-112605690 GAAGCATGGAGAAGTACTCCGGG + Exonic
961011999 3:123442717-123442739 GATCCCTGGGGGAGGACTTCAGG - Intronic
963392737 3:144688985-144689007 CATAACTGGAGGAGTACTCCTGG + Intergenic
963901663 3:150738820-150738842 GATACAAGGAGAATTTCTTCAGG + Intergenic
964340176 3:155699983-155700005 GATAGATGGAAGTGTTCTTCAGG - Intronic
964452885 3:156828606-156828628 GATAAATGGAGGAGCACTTTGGG - Intronic
966611259 3:181870045-181870067 GATACATGCTGAAGTACTTAGGG - Intergenic
967072173 3:185971736-185971758 GCGAGGTGGAGGAGTACTTCTGG + Intergenic
970475625 4:16419384-16419406 TATACATGGAGAAGGACTTGTGG - Intergenic
971676832 4:29642233-29642255 GAAACATGGAGGAGTAAAACTGG - Intergenic
976138175 4:81961130-81961152 GATATATGGAAGTGTGCTTCTGG - Intronic
978836805 4:113160622-113160644 AATAGATGGAGAAGTATTTCTGG - Intronic
979734077 4:124060849-124060871 GATACAGTGAGGAGTATTTTCGG + Intergenic
981140958 4:141268722-141268744 GATACATAGGGGAGGACCTCTGG - Intergenic
982628499 4:157800753-157800775 GTTACATGGATGAGTTCTTTAGG + Intergenic
983148637 4:164248126-164248148 GATACATGGAGGAGTACTTCAGG - Intronic
986561116 5:9061640-9061662 GAAAGATGGAGGAGTGTTTCAGG + Intronic
988811398 5:34788551-34788573 AATATATGAATGAGTACTTCTGG + Intronic
990914426 5:60888643-60888665 GATAGATGGAGGAGTTCATTTGG + Intronic
991036791 5:62135573-62135595 GAAACATGGATTAGTATTTCAGG - Intergenic
992985133 5:82220728-82220750 GAGAGATGGAGTAGTACATCAGG - Intronic
994747521 5:103697221-103697243 GAAAGATGGAGGATTACTGCAGG - Intergenic
1001990296 5:176110978-176111000 CATTCATGGATGGGTACTTCAGG - Intronic
1002226576 5:177727162-177727184 CATTCATGGATGGGTACTTCAGG + Intronic
1002267268 5:178044051-178044073 CATTCATGGATGGGTACTTCAGG - Intronic
1005187741 6:23181836-23181858 GATACATGAAGGACTGCTTCAGG - Intergenic
1006168557 6:32080016-32080038 GCTACATGGGGGACTACTTTGGG + Intronic
1010157988 6:72817125-72817147 GATATATGGAAGAGTTCATCTGG + Intronic
1014433634 6:121397941-121397963 GAGACAAGGAGGAGGACTTTTGG + Intergenic
1015731402 6:136351958-136351980 GATTCATGGTAGAGTGCTTCTGG + Intronic
1015818949 6:137239642-137239664 CATACATGGAGGAGTAGTGTAGG + Intergenic
1016084248 6:139893568-139893590 GAAAGATGGAGGAAGACTTCAGG + Intergenic
1016641460 6:146353981-146354003 GATACATGGAGACTTACTTAGGG - Intronic
1019209695 6:170395107-170395129 GAGGCATGGAGCAGCACTTCTGG - Intronic
1020880852 7:13761768-13761790 TACACATGGAGGAATACATCAGG - Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1024219504 7:47276899-47276921 GATAAATGCAGGCGAACTTCAGG + Exonic
1030127342 7:106166913-106166935 CATACATGAAGCAGTAATTCAGG - Intergenic
1038676562 8:29628144-29628166 GAAGCATGGAGAAGTAATTCTGG + Intergenic
1040740251 8:50565575-50565597 AATACATGGATGAATACATCAGG - Intronic
1041137817 8:54779052-54779074 GAAAGATGGAGGAGAACTGCAGG - Intergenic
1042765583 8:72317828-72317850 GATACAGGGAGGAGCATTCCAGG - Intergenic
1042910141 8:73817937-73817959 GATACATGGGGGATTACAGCAGG - Intronic
1044422121 8:92008728-92008750 GATACATTAAATAGTACTTCTGG + Intronic
1044462692 8:92464396-92464418 GTTACATGGATAAGTTCTTCAGG - Intergenic
1049080181 8:140436774-140436796 GATACAATAAGGAGTACTTAGGG + Intronic
1049841150 8:144773265-144773287 GTTACATGGAGAAGTCCTCCCGG + Exonic
1053069245 9:35091460-35091482 GACACATGCAGGAGGAGTTCCGG - Exonic
1054750252 9:68898132-68898154 GCTACATGGAGGAGTTGGTCAGG - Intronic
1059432005 9:114255832-114255854 GATACATGGGGGTGAAATTCTGG + Intronic
1187887781 X:23905523-23905545 GAGACAGGTAGGAGTTCTTCAGG - Intronic
1187891947 X:23944768-23944790 GATACATGTAGGAGAACTTCTGG + Intergenic
1189391003 X:40576803-40576825 GAGACATGGAGAAGTATTTAGGG - Intergenic
1192008686 X:67243933-67243955 AATACAAGGAAGACTACTTCAGG + Intergenic
1193824289 X:86203975-86203997 GAAACATGGAGCAGTGCTTGTGG + Intronic