ID: 983151561

View in Genome Browser
Species Human (GRCh38)
Location 4:164288770-164288792
Sequence TGGGAGTCCTTTTGAAACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983151559_983151561 -6 Left 983151559 4:164288753-164288775 CCTACTCGACACATGAGTGGGAG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 983151561 4:164288770-164288792 TGGGAGTCCTTTTGAAACACGGG 0: 1
1: 0
2: 0
3: 13
4: 161
983151556_983151561 27 Left 983151556 4:164288720-164288742 CCAAATGTTCATCTTTCATCACA 0: 1
1: 0
2: 0
3: 25
4: 275
Right 983151561 4:164288770-164288792 TGGGAGTCCTTTTGAAACACGGG 0: 1
1: 0
2: 0
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983151561 Original CRISPR TGGGAGTCCTTTTGAAACAC GGG Intronic
901150188 1:7096201-7096223 CTGGAGTCTTTTTGAAACTCAGG - Intronic
902598294 1:17523857-17523879 TGGGAATGCCTTTGAAACATTGG + Intergenic
905317178 1:37090220-37090242 TGAGAGTCCATTTGAATCAGTGG - Intergenic
909250864 1:73354316-73354338 TGAGAATCATTTTGAAATACAGG + Intergenic
909961437 1:81849234-81849256 TGTGAGTCCATTTGAAAGGCTGG + Intronic
916031201 1:160878954-160878976 TGAGATTCCTTGAGAAACACAGG - Intronic
917086408 1:171309199-171309221 TGGGAGTTCCTTGGAATCACCGG + Intergenic
917798910 1:178552778-178552800 TGGCAGACCTTATCAAACACTGG + Intergenic
918256992 1:182757774-182757796 TGGGAGTTTTTTCAAAACACAGG - Intergenic
924217359 1:241837614-241837636 TGGGAGTCCTCATGGACCACGGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063256912 10:4338426-4338448 TGCCAGTCCTTTTGCAGCACAGG + Intergenic
1064706835 10:18081734-18081756 TGGGAGGACTTTTGAAAGAAGGG - Intergenic
1067727238 10:48779470-48779492 TGGGAGGCCCTATGAAACAGTGG + Intronic
1068318732 10:55382097-55382119 TGGGTCACATTTTGAAACACTGG + Intronic
1069663983 10:70142889-70142911 TGTGAGTCCTGCTGTAACACAGG - Intronic
1069931823 10:71888005-71888027 TGGCTGCCCTTTTGAAAAACTGG + Intergenic
1071339603 10:84632207-84632229 TGGAATTCCTCTTGAAAGACTGG - Intergenic
1073273121 10:102283806-102283828 TCGGAGTTCTTTGGAAACACAGG - Intronic
1076717840 10:132375554-132375576 TGTGAGTACTTTTGTAACAAGGG - Exonic
1078043425 11:7890721-7890743 TGTGACTCCGTTTGAAACTCAGG + Intergenic
1078462949 11:11529118-11529140 TGGGTATCCTGGTGAAACACAGG - Intronic
1079794757 11:24787128-24787150 TGGGTACCCTTCTGAAACACTGG + Intronic
1080645769 11:34186550-34186572 TTGGAGTGTTTTTGTAACACGGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1087151201 11:94861282-94861304 AGGGAAGCCTTTTGAAACATTGG + Intronic
1087841945 11:102929543-102929565 TTTGAGTCCTTTAGAAACATTGG + Intergenic
1089808201 11:121110755-121110777 TGGAAGTTTTTTTGAAAAACTGG - Intronic
1090623888 11:128588011-128588033 AGGGATTGCTTTAGAAACACAGG + Intergenic
1092005281 12:5064158-5064180 TGGGAGAGCTTTGGAAACTCGGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096324875 12:50650923-50650945 TGGGAATCCTTGTGCACCACTGG - Intronic
1097902773 12:64889904-64889926 TGGGAGACCTTGAGGAACACAGG - Intergenic
1098322490 12:69260051-69260073 TGGGAGTGCTATTGAGACACTGG + Exonic
1099047486 12:77739897-77739919 TGTGAGTCATTATAAAACACTGG - Intergenic
1099465419 12:82980629-82980651 TGTGAGTCCTTTAGAAAAATAGG + Intronic
1100309713 12:93382961-93382983 TGGAAGCCTTTTTTAAACACAGG + Intronic
1100594381 12:96059228-96059250 TGGGAGGATTTTTAAAACACAGG - Intergenic
1104830872 12:131750371-131750393 TTGGAGTCCTTTTGAGAGACAGG + Intronic
1107407146 13:40125599-40125621 TGGGGATCCTGTTGAAAAACAGG - Intergenic
1109859969 13:68184603-68184625 TTGGAATCCTTTTGAAAGAGTGG + Intergenic
1110466339 13:75806510-75806532 TGGCAGTTCTTTTGAAAAGCCGG + Intronic
1113437317 13:110303356-110303378 TGGGAGCTCTTTTTTAACACTGG + Intronic
1115202509 14:30869964-30869986 TGGGAGGCATTAGGAAACACTGG - Intergenic
1115751527 14:36498064-36498086 TGGTAGCCATTTTGAAACGCTGG - Intronic
1118297281 14:64582084-64582106 AGGGAGTCTTTTTGAAACTCAGG + Intronic
1121805579 14:96818039-96818061 TGGGAGACCTGTTGAGACCCAGG + Intronic
1122082691 14:99276898-99276920 TGTGAGTCCTTTTCATATACGGG - Intergenic
1122469841 14:101958904-101958926 TGGGAGATATTTTGAAACTCTGG + Intergenic
1122573493 14:102725371-102725393 TGGGAGTCCTTTTTAAAAAATGG + Intronic
1122765769 14:104068765-104068787 TGGGAGGCATTTTGCAACACGGG - Intergenic
1124203436 15:27697832-27697854 TGGTATTGCTTTTGAAACTCAGG - Intergenic
1126566121 15:50101347-50101369 TGTGAGTCTTTATGACACACAGG - Intronic
1128148317 15:65344983-65345005 TGGGACTGCTTTTGAAAACCTGG - Intronic
1131224999 15:90617154-90617176 GGGGAGCCCTTTAGAGACACAGG - Intronic
1131970145 15:97883645-97883667 TGTCAGTCCCTTTAAAACACTGG + Intergenic
1140243295 16:73224697-73224719 TAGGTGTCTTTTTCAAACACAGG + Intergenic
1142981775 17:3676670-3676692 TTGGAATCTTGTTGAAACACAGG + Intronic
1143520754 17:7442990-7443012 AGGGAGCCCTTTTGGAGCACTGG + Intronic
1148785549 17:50144475-50144497 TGGGAGCCATTTCGAAGCACAGG - Intronic
1153524597 18:5982544-5982566 TGGGAGTCTTTATGAAACCCAGG - Intronic
1154272115 18:12929325-12929347 TGGGAGTTCTCTGGGAACACTGG - Intronic
1157975133 18:52318492-52318514 AAGGACTCCATTTGAAACACAGG + Intergenic
1158255597 18:55544898-55544920 TGGTAGTACTCTAGAAACACTGG - Intronic
1159594585 18:70370730-70370752 TGGGATTCCTTTTAAAACTTAGG + Intergenic
1159698471 18:71591789-71591811 TGGATCTTCTTTTGAAACACTGG - Intergenic
1163891412 19:20019274-20019296 TGAGAGGCCTTTTGAGCCACTGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926351606 2:12000391-12000413 TAGGAGTCTTATTGATACACTGG + Intergenic
926975757 2:18515247-18515269 GGGGAGTCCCTTTGAAACAGAGG - Intergenic
930089123 2:47519138-47519160 TGGGATTGGTTTTTAAACACAGG - Exonic
937643868 2:124244244-124244266 TTGGAATCATTTAGAAACACAGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
944449648 2:199828152-199828174 TGAGATTTTTTTTGAAACACAGG - Intronic
1170781949 20:19433806-19433828 TGTGAGTCCTTTTAAACCATGGG - Intronic
1174799479 20:53551024-53551046 TGGGCTTCCTTTTGAGACAATGG + Intergenic
1176929699 21:14794128-14794150 TGGAAGTCCTTTTAAAATAGGGG - Intergenic
1182990002 22:34758421-34758443 TGGGATTCATTTTGAAGAACTGG + Intergenic
952423879 3:33155199-33155221 TGGGAGTCCTTTTTAAATTCTGG - Intronic
954520046 3:51216829-51216851 TAGGAGTCTTTTTCAAACCCTGG + Intronic
955581206 3:60425017-60425039 TGGGAGCCTTTCTGAGACACAGG + Intronic
956802765 3:72777357-72777379 AGGAAGTCCTATTGAAAAACAGG + Intronic
957195234 3:77059244-77059266 TTGGAGTCCCTTTGAAAGCCTGG + Intronic
959008703 3:101049372-101049394 TGGGAGTTCTTTTGCAAGGCAGG + Intergenic
960285909 3:115828378-115828400 TGAGAGTCCTTTTTAAAAAGTGG - Intronic
960422928 3:117470517-117470539 TGGCAGTCATTTAGAAGCACTGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
970316490 4:14832913-14832935 AGGGAGTCCTTGTGAGACCCAGG + Intergenic
970949823 4:21741674-21741696 GGAGAGCACTTTTGAAACACTGG + Intronic
971826502 4:31630415-31630437 TAGGAGTGCTTTTGCAACATTGG - Intergenic
974963513 4:68732197-68732219 TGGGAGTTAATTTGAATCACGGG - Intergenic
975822710 4:78288075-78288097 TGAGACTTCTATTGAAACACTGG - Intronic
976068221 4:81214459-81214481 TGGGTGTCCTTTTGTCACTCTGG - Intronic
978589711 4:110311824-110311846 TGGGATTCGCTTTAAAACACTGG + Intergenic
979977255 4:127212302-127212324 TAGCAGTTCTTTTGAAAGACAGG - Intergenic
980121704 4:128734672-128734694 TGGGAGTCTTTTCAAAACACTGG - Intergenic
980292309 4:130859322-130859344 TGGGAGACAATTTGAATCACAGG + Intergenic
980869177 4:138591821-138591843 TAGGAGTCATTCTGTAACACTGG - Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983151561 4:164288770-164288792 TGGGAGTCCTTTTGAAACACGGG + Intronic
983872340 4:172836462-172836484 TGGGAGTCATCTCCAAACACAGG - Intronic
984031504 4:174610130-174610152 TTGGTGTCCTTTTGAGACTCAGG - Intergenic
986573503 5:9189336-9189358 GTGGAGTTCATTTGAAACACTGG - Intronic
986934421 5:12865748-12865770 TAGGAATGCTTTTAAAACACAGG - Intergenic
987093222 5:14525701-14525723 TGGAAGTCTTTGTGAACCACAGG - Intronic
987710830 5:21499177-21499199 TGGGACTCCCGTTGACACACAGG + Intergenic
987897711 5:23969679-23969701 TGGTACTCCCTTTGAAACTCTGG + Intronic
987986877 5:25158581-25158603 TTGGAGTCCTTTTTAGACCCAGG + Intergenic
990464127 5:56056236-56056258 GGGGAGTGCTTCTGAAAGACAGG + Intergenic
991761170 5:69918235-69918257 TGGGACTCCCGTTGACACACAGG + Intergenic
991786159 5:70199865-70199887 TGGGACTCCCGTTGACACACAGG - Intergenic
991840398 5:70793285-70793307 TGGGACTCCCGTTGACACACAGG + Intergenic
991878603 5:71200251-71200273 TGGGACTCCCGTTGACACACAGG - Intergenic
992453177 5:76891661-76891683 GAGGAGTCGTTTGGAAACACTGG + Intronic
992626991 5:78645219-78645241 TGGAAGTCCTTTGAAAACAGAGG + Intronic
993507245 5:88724707-88724729 TATGAATCCTTTTGAAATACAGG - Intronic
993610630 5:90049908-90049930 TGGGTGTCCTTCTGGAACTCTGG + Intergenic
994867988 5:105302954-105302976 TGGAAATCCTTATGAAATACAGG - Intergenic
995332830 5:110964830-110964852 TGGGACTCCATTTGAAGCACAGG - Intergenic
999366207 5:151025328-151025350 TGGCAGTCCATCTGGAACACAGG - Exonic
999566608 5:152870181-152870203 TGGCAGTCTTGGTGAAACACAGG - Intergenic
1000462309 5:161537866-161537888 TGGAAGTCATTTTAAAAGACTGG - Intronic
1000534007 5:162457879-162457901 TGGGAGCCATTTTGAAAGCCTGG + Intergenic
1002843044 6:922462-922484 TGGTTGTCCTTCTGAAAGACAGG - Intergenic
1003269011 6:4591066-4591088 TGGGTGTCCTCATAAAACACAGG + Intergenic
1004059863 6:12183199-12183221 TTGTAATCCTTTTGAAAAACAGG + Intergenic
1004592667 6:17068881-17068903 TGGGAGATCATTTGAATCACGGG + Intergenic
1005546857 6:26881325-26881347 TGGGACTCCCGTTGACACACAGG - Intergenic
1006738314 6:36290901-36290923 TGAGATTCCTATTAAAACACTGG - Intronic
1008153989 6:47990462-47990484 TGGGAGACATTTTGAATCATGGG + Intronic
1008588381 6:52969658-52969680 TGGGAGCCTTTTAGAAATACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010798192 6:80142516-80142538 TAGGAGTCCCTTTGGGACACAGG + Intronic
1010828882 6:80506950-80506972 TGGTATTCCTTTTAAAAGACAGG - Intergenic
1012249658 6:96965524-96965546 TGGGAGTGTTTTAAAAACACTGG + Intronic
1012678231 6:102144107-102144129 TGTGATTCCATTTAAAACACAGG - Intergenic
1015051594 6:128847451-128847473 TCGGACTCATATTGAAACACTGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016098413 6:140066758-140066780 TTGGATTCTTTTTGAAATACAGG - Intergenic
1016731320 6:147431403-147431425 TGGAGGTCCTGTTAAAACACAGG + Intergenic
1019156346 6:170041482-170041504 TGTGGGGCCTTTTGTAACACAGG + Intergenic
1019270584 7:144987-145009 CTGGAGTCCTTTTGTAACACTGG + Intergenic
1019342569 7:515529-515551 TGGGGGACCTTTTGTAACATAGG - Intronic
1026524305 7:71141043-71141065 TGAGTGTCCTTTTAATACACTGG - Intronic
1027672715 7:81121124-81121146 TGGGAGTTGTCTTGAAATACAGG - Intergenic
1028663084 7:93305935-93305957 TGGGAATCCATTTGAAATTCAGG + Exonic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031213929 7:118866334-118866356 TGGGAGTTCATTTGAAAAACAGG + Intergenic
1032211211 7:129915773-129915795 TAGGAGTTCTCTTGAAAGACAGG - Intronic
1036131350 8:6116750-6116772 TGCAAGTACTTTTGAAAGACTGG - Intergenic
1036952159 8:13151105-13151127 TGTGAATCCTTATAAAACACGGG + Intronic
1042110302 8:65374606-65374628 TGAAAATCCTTATGAAACACCGG + Intergenic
1046452354 8:114410664-114410686 TGAGAGTTCTTTTTAAACTCTGG + Intergenic
1047191773 8:122684944-122684966 TGGGAGTGATTTTGCCACACGGG + Intergenic
1047438224 8:124853447-124853469 CTGGAGTCCTTTTTAAACAAAGG - Intergenic
1052418323 9:28206478-28206500 TGTGAGTCATTTTGAAACCTTGG - Intronic
1053099512 9:35359408-35359430 TGGGAATGCTTATGAAACTCGGG - Intronic
1058154554 9:101500656-101500678 TGTGAGTCCTTTTGAAAAGAAGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059745210 9:117193709-117193731 TGGGATTATTTTTGAAACATAGG - Intronic
1185894451 X:3844911-3844933 TGGTAGGCCTTTTGGAGCACTGG + Intergenic
1185899569 X:3883335-3883357 TGGTAGGCCTTTTGGAGCACTGG + Intergenic
1185904685 X:3921764-3921786 TGGTAGGCCTTTTGGAGCACTGG + Intergenic
1187480501 X:19650671-19650693 TGGCATTCCTTTTACAACACTGG + Intronic
1187972463 X:24672676-24672698 TTGGAGTTCTTTTGAGTCACAGG + Intronic
1188794078 X:34441258-34441280 TGGGAGATCATTTGAATCACGGG - Intergenic
1190558443 X:51662554-51662576 TGGGAATCCTTTGAAAGCACTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193066203 X:77263353-77263375 TGGGAGTACTGTTTAAACCCAGG - Intergenic
1193813874 X:86083085-86083107 TGGGAGATCATTTGAATCACGGG - Intergenic
1195848485 X:109255604-109255626 TAGGAGTCCTTTGGATACCCGGG - Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic