ID: 983157510

View in Genome Browser
Species Human (GRCh38)
Location 4:164369094-164369116
Sequence AGTGGGCTGCTCCGGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983157501_983157510 17 Left 983157501 4:164369054-164369076 CCTATGACTGAACGTTTATATCA 0: 1
1: 0
2: 0
3: 5
4: 102
Right 983157510 4:164369094-164369116 AGTGGGCTGCTCCGGGGATGAGG 0: 1
1: 0
2: 0
3: 18
4: 247
983157506_983157510 -10 Left 983157506 4:164369081-164369103 CCTCTCTCAGGTAAGTGGGCTGC 0: 1
1: 0
2: 1
3: 7
4: 145
Right 983157510 4:164369094-164369116 AGTGGGCTGCTCCGGGGATGAGG 0: 1
1: 0
2: 0
3: 18
4: 247
983157505_983157510 -9 Left 983157505 4:164369080-164369102 CCCTCTCTCAGGTAAGTGGGCTG 0: 1
1: 0
2: 0
3: 16
4: 161
Right 983157510 4:164369094-164369116 AGTGGGCTGCTCCGGGGATGAGG 0: 1
1: 0
2: 0
3: 18
4: 247
983157500_983157510 30 Left 983157500 4:164369041-164369063 CCATCAGAGTTGTCCTATGACTG 0: 1
1: 0
2: 2
3: 10
4: 143
Right 983157510 4:164369094-164369116 AGTGGGCTGCTCCGGGGATGAGG 0: 1
1: 0
2: 0
3: 18
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983157510 Original CRISPR AGTGGGCTGCTCCGGGGATG AGG Intronic
900115546 1:1026397-1026419 ATGGGGCTGCTCCAGGGAAGGGG + Intronic
900154014 1:1196902-1196924 AGGGGGCTGCTCTGAGGAGGGGG - Intronic
900322981 1:2094164-2094186 GGGGGGCTGCTCCCGGGACGGGG - Intronic
901906298 1:12414642-12414664 AGTGGGCTGCTTCCAAGATGGGG + Intronic
903545419 1:24120859-24120881 TGTGGGCTGCTCCAGGTCTGAGG + Exonic
903572645 1:24317875-24317897 AGAGGGCTGCTCTGAGGAGGTGG + Intergenic
905425597 1:37881422-37881444 AGTGTGGTGCTCCAGGGAAGAGG - Intronic
913192048 1:116421056-116421078 TGTGGGCTGCTCCAGGAAGGGGG - Intergenic
914885574 1:151581741-151581763 AGTGGGCTTCTCCGAGGCAGAGG - Exonic
915145943 1:153795731-153795753 ACAGGGCTGCTCCTGGGATTGGG + Intergenic
917194461 1:172450712-172450734 ACGGGGCTGCTCCGGGGCAGGGG - Intronic
919641011 1:200043241-200043263 AGTGGGCTGCTGCTGAGAAGCGG + Intronic
921006583 1:211099915-211099937 AGTGGCCTGGTCAGGGGAAGAGG - Intronic
923684031 1:236142129-236142151 AGCGCGCGGCCCCGGGGATGGGG + Intergenic
923684081 1:236142246-236142268 AGCGCGCGGCCCCGGGGATGGGG + Intergenic
924678452 1:246205003-246205025 AGTGTGCTGCTCTGCGGAGGGGG + Intronic
1063949829 10:11212191-11212213 AGGGGCCTGCTGCAGGGATGTGG - Intronic
1064244427 10:13657571-13657593 GGAGGGGTGCTCCGGGGAGGAGG + Intronic
1064340953 10:14484839-14484861 AGTCGGCTGCTTCCTGGATGGGG - Intergenic
1065528092 10:26642939-26642961 GGCGGGCTGCTGTGGGGATGGGG + Intergenic
1066672963 10:37859135-37859157 GGTGGGCTGCTTCCGAGATGGGG + Intergenic
1067032000 10:42884494-42884516 AGCGGGCTGCTCAGGGGAAGTGG + Intergenic
1067225046 10:44370460-44370482 AGTGGTCTGCTTAGGGGATTTGG + Intronic
1067587571 10:47485008-47485030 ATGGGGCAGCTCCGGGGCTGGGG - Intergenic
1067634626 10:47992774-47992796 ATGGGGCGGCTCCGGGGCTGGGG - Intergenic
1068283882 10:54910093-54910115 AGTTAGCTGCTTCAGGGATGTGG + Intronic
1069707299 10:70466980-70467002 AGTGGGCTGCTGCTGGCAGGAGG - Intergenic
1071513615 10:86282739-86282761 AGTGGGGGGCTCAGAGGATGTGG - Intronic
1073733557 10:106320234-106320256 AGTCAGCTGCATCGGGGATGTGG - Intergenic
1074205021 10:111275623-111275645 GGTGGCCTGCTCTGGGGGTGGGG + Intergenic
1075122069 10:119671633-119671655 ACTGGGCTGCTCTGAAGATGAGG - Intronic
1075467146 10:122660276-122660298 GCAGGGCTGCTCCAGGGATGGGG + Intergenic
1076065113 10:127442353-127442375 AGTGGGCAGCTCTGGGCTTGGGG - Intronic
1076478070 10:130766409-130766431 AGTGGGGTCCTCCAGGCATGAGG + Intergenic
1076784192 10:132741329-132741351 AGTGGGCAGCTCCGTGTCTGTGG + Intronic
1076998540 11:311009-311031 AGAGCGCGGCTCCGGGGCTGGGG - Intronic
1077000203 11:318750-318772 AGAGCGCGGCTCCGGGGCTGGGG + Intergenic
1077378740 11:2218004-2218026 CGTGGGCTGCCCCTGGGCTGGGG - Intergenic
1078916305 11:15781881-15781903 AGTGAGGTGCCCCAGGGATGAGG + Intergenic
1080823745 11:35830608-35830630 AGTGGGCCACTCAGGAGATGAGG - Intergenic
1081633075 11:44702497-44702519 AGTGGGCTTCTCGGGGGAGATGG + Intergenic
1081679187 11:44989832-44989854 GGTCTGCTGCTCCAGGGATGCGG - Intergenic
1083755392 11:64789297-64789319 ACTGGGCTGCCTCGGGGATGGGG + Exonic
1083769042 11:64856208-64856230 AGGGGGCAGCTCGGGGGAAGGGG - Intronic
1083960509 11:66012567-66012589 AGTGGGCAGCTCCCTAGATGGGG + Intronic
1089555016 11:119311436-119311458 AGGAGGCAGCTCAGGGGATGGGG + Intronic
1092233647 12:6792165-6792187 AGTGGGCTGCTTGGGGGTTATGG + Intronic
1093406793 12:18814062-18814084 TGTGGCCTGCTCCAGGGAAGGGG - Intergenic
1094017872 12:25884183-25884205 AGTCGGCTGCCTCGGGGATGGGG - Intergenic
1095633377 12:44403187-44403209 AGTTGGCTGGTCAGGGGTTGTGG + Intergenic
1097454590 12:59781959-59781981 AGTGGCCTTCTCCAGGGAGGAGG + Exonic
1097865824 12:64558496-64558518 AGTGGGCAGTTCTGGGGGTGTGG + Intergenic
1098461448 12:70737038-70737060 AGGGGGCTGCTCCAGCGAAGTGG - Intronic
1102853798 12:116277016-116277038 AGGGGGCTGTGCCGGGGAAGGGG - Intronic
1102947256 12:117000500-117000522 AGTCGGAAGCTCCGGGGGTGGGG - Intronic
1105202598 13:18192783-18192805 AGAGGGCTTCTCAGGGGAGGAGG + Intergenic
1108134306 13:47338737-47338759 AGTGGGGTGCTCCATTGATGTGG - Intergenic
1108640426 13:52378182-52378204 CGCGGGCTGCTCCGGAAATGGGG + Exonic
1113656594 13:112071971-112071993 GGTGGGTTTCTCCGGGGAAGGGG - Intergenic
1113799804 13:113080502-113080524 AGGGGGCTGGTCCTGGGTTGAGG - Intronic
1113970463 13:114185087-114185109 AGTTGGCTGCCTTGGGGATGTGG - Intergenic
1114556920 14:23567485-23567507 AGTGGGCTTCTCGGGCGGTGGGG - Exonic
1116872655 14:50082939-50082961 AGTCAGCTACACCGGGGATGGGG + Intergenic
1120212630 14:81649006-81649028 AGTGGGATGCTGCGGGGAGGTGG + Intergenic
1123005998 14:105324184-105324206 AGTGGGCAGCTGCGGTGCTGTGG + Intronic
1125581573 15:40789389-40789411 AGTGGGCTGGTTTGGGGAAGTGG - Intronic
1126327958 15:47502375-47502397 AGTGGGCTCCTCTGGGAATCTGG + Intronic
1127556627 15:60094211-60094233 AGTGGGCTTCTCTGGGGGAGTGG - Intergenic
1132497456 16:270633-270655 AGTGGGCAGCTCCGGGGGCCAGG + Exonic
1132505896 16:308528-308550 AGAGGGCTGTTCCGGGCCTGTGG + Intronic
1132607645 16:800231-800253 AAAGGCCTGCACCGGGGATGGGG - Intronic
1132939558 16:2500086-2500108 CGTGCGCTGCTCCGGGGCAGGGG + Intronic
1133138638 16:3729191-3729213 AGGGGGCTGGGCCGGGGGTGGGG + Exonic
1135052431 16:19203834-19203856 GGTGGGCTGCGCATGGGATGGGG + Intronic
1137594088 16:49712464-49712486 AGAGGGCTACTCAGGGGCTGAGG + Intronic
1138113432 16:54342153-54342175 GGTGTGGTGCTCCGGGGCTGGGG + Intergenic
1139791498 16:69440449-69440471 AGTGGGTACCTCTGGGGATGAGG - Intronic
1141632197 16:85294192-85294214 AGTGGGCTGCTCTGGGGTGGAGG - Intergenic
1141785186 16:86194937-86194959 AGTGGGAGGCTCAGGGGCTGGGG + Intergenic
1142534524 17:605269-605291 AGTGGGATGAGCTGGGGATGAGG + Intronic
1142993275 17:3746136-3746158 AATGTGCTGCTCCGGGTTTGGGG - Intronic
1143100028 17:4499650-4499672 CGCGGGCTGCTCCAGGGGTGGGG - Intronic
1144754474 17:17670785-17670807 ACTGGTAGGCTCCGGGGATGAGG - Intergenic
1144872729 17:18380860-18380882 AGTGGGCAGCTCGGTGGAAGAGG - Intronic
1144944764 17:18964204-18964226 TGTGGGCAGCCCTGGGGATGCGG - Intronic
1145287658 17:21518438-21518460 CCTGGACTGCTCCTGGGATGTGG - Intergenic
1145798871 17:27671165-27671187 CGGGGGCTGGTCCCGGGATGGGG - Intergenic
1147000730 17:37359826-37359848 AGTGGGCTGTCTCGGGGCTGAGG - Intronic
1147198938 17:38786521-38786543 AGTGAGCTGCTCTGGAGCTGAGG - Intronic
1147240596 17:39088067-39088089 GGAGGGCTGCTCAGGGGAAGTGG - Intronic
1148055726 17:44794211-44794233 AGGGGTCTGCTCTGGGGAGGGGG - Intergenic
1148851002 17:50555339-50555361 AGGGGGCAGCTCTGGGGAGGTGG - Intronic
1149557178 17:57581682-57581704 AGTGGGCAGCCCTGGGGATCTGG - Intronic
1150303346 17:64064135-64064157 AGTGTGCTGCCGCGGGGCTGTGG + Exonic
1151198690 17:72451778-72451800 AGTGAGCAGCTCTGGAGATGAGG + Intergenic
1152250343 17:79209237-79209259 ACTGGCCTGCTCCTGGGATGGGG - Intronic
1152649968 17:81488245-81488267 AGGAGGCTGGTCCGGGGCTGGGG - Intergenic
1203159777 17_GL000205v2_random:38705-38727 AGATGGATGCTCCAGGGATGTGG - Intergenic
1157572707 18:48723580-48723602 GGTGGGCAGCTCAGGGGGTGGGG + Intronic
1158488788 18:57891576-57891598 AGGTGGCTGCTCCAGGGTTGTGG + Intergenic
1158775541 18:60574113-60574135 AGTGGGGAGCTGCGGGCATGGGG + Intergenic
1158920568 18:62187195-62187217 AGTGGGCTGGGGCGGGGCTGGGG + Intergenic
1161346249 19:3770185-3770207 AGTGGGCAGCTCTGCTGATGGGG + Exonic
1162746151 19:12799907-12799929 TGTGGGACGCTCCGTGGATGAGG - Exonic
1162947681 19:14053770-14053792 GGCGGGCTGCTCTGGGGCTGGGG + Exonic
1163144228 19:15369897-15369919 TGTGGGCTGCAGTGGGGATGGGG - Intronic
1164635381 19:29787681-29787703 CCTGGGCTGCTCCAGGGCTGCGG - Intergenic
1164745616 19:30610507-30610529 ATTGGGCTGATCCTGGGGTGAGG + Intronic
1164752929 19:30669550-30669572 AGTGGGATTCTCCGGGGCTGAGG - Intronic
1166369906 19:42294929-42294951 AGGGGGCTGCTCCGTGGGAGTGG - Exonic
1167258575 19:48444685-48444707 AGTGGGGTGGTCCGGAGGTGCGG - Exonic
1168232377 19:55041349-55041371 ATTGGGGTGCTCCTGGCATGTGG + Intronic
1168686358 19:58351716-58351738 AGAGGGCAGCTCCAGGGATGGGG - Intronic
925046187 2:774249-774271 AGTGGGCTGCACGGGGTCTGAGG + Intergenic
925269167 2:2590160-2590182 CCTGGGCTGCTCCAGGAATGAGG - Intergenic
925599036 2:5589308-5589330 AGTGGGCTGAGGCAGGGATGTGG + Intergenic
929713332 2:44286863-44286885 AGTGAGCTGCTGCAGGGAGGTGG + Intronic
931300302 2:60973047-60973069 AGTTGGCTGCCTCGGGGATGTGG - Intronic
931653088 2:64486243-64486265 ACTGGCCTGTTTCGGGGATGAGG - Intergenic
931706658 2:64951840-64951862 GGAGGCCTGCTCCAGGGATGGGG + Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
932751695 2:74375411-74375433 ACTGGGGTGCTCCGGGGTGGGGG + Intronic
934519830 2:95013185-95013207 AGAGGGCTGCTTCTGGGATGTGG - Intergenic
934925236 2:98377547-98377569 AGTGGGGAGCCCCTGGGATGAGG + Intronic
935526998 2:104182651-104182673 AGTGGGCTGCTTCAGGAAGGTGG - Intergenic
938367863 2:130749316-130749338 AGTGGCCTGCTGAGAGGATGAGG - Intergenic
939494052 2:142907165-142907187 GGTGGGCTGCTCCCAAGATGGGG + Intronic
940108025 2:150119977-150119999 AATGGGCTGCTCCAGGAAGGTGG + Intergenic
941043411 2:160648243-160648265 AGTCGGCTGCCTCGGGGACGCGG - Intergenic
942053689 2:172163203-172163225 AGTTGGCTGCTTTGGGGATGTGG + Intergenic
946295980 2:218783762-218783784 AGTAGGCTGGTCCTGGGCTGGGG + Intronic
946825681 2:223675188-223675210 AGTAGGTGGCTCCTGGGATGTGG + Intergenic
1169029549 20:2396939-2396961 AGTCGGCAGCTCTGGGGGTGGGG - Intronic
1169959089 20:11138806-11138828 GGTGGGCTGCCCCTGGGCTGGGG + Intergenic
1171123685 20:22584798-22584820 AATGGGCTGCCCCGGGTCTGGGG - Intronic
1172191574 20:33064849-33064871 AGTGTGGTGCCCGGGGGATGGGG + Intronic
1172760392 20:37317301-37317323 AGGGCCCTGCCCCGGGGATGAGG + Intergenic
1172887443 20:38240727-38240749 AGTGGGGGGCTCAGGGGAGGAGG + Exonic
1173905644 20:46626682-46626704 AGTGGGAAGGTCAGGGGATGAGG - Intronic
1175633290 20:60559959-60559981 AATGGGCTGCCCCGAAGATGAGG + Intergenic
1175960172 20:62631811-62631833 AGTCGGCTGCCTCGGGGACGTGG + Intergenic
1176048075 20:63102867-63102889 TGCGGGCCGCTCCGGGGAAGCGG + Intergenic
1176119942 20:63449867-63449889 AGTGGGCTGGTCCTGGTTTGGGG - Intronic
1176715356 21:10345228-10345250 AGAGGGCTTCTCAGGGGAGGAGG - Intergenic
1179480226 21:41672246-41672268 AGTGGCCTGCTCAGGTGATCCGG - Intergenic
1180602995 22:17034724-17034746 AGAGGGCTTCTCAGGGGAGGAGG + Intergenic
1180787186 22:18553613-18553635 AGTGGGCTAATGCTGGGATGAGG + Intergenic
1181081315 22:20417703-20417725 TGGGGCCTGCTACGGGGATGTGG - Intergenic
1181161554 22:20962913-20962935 GGTGGGGTGCTCCAGGGCTGGGG + Intergenic
1181234554 22:21441693-21441715 AGTGGGCTAATGCTGGGATGAGG - Intronic
1181244094 22:21493138-21493160 AGTGGGCTAATGCTGGGATGAGG + Intergenic
1181531681 22:23520967-23520989 CGTGGGCTGCTCCTGGGGTATGG - Intergenic
1181673098 22:24435052-24435074 ACTGGGCTGCTCCAGGGAAGGGG + Intronic
1181730810 22:24845008-24845030 TGTGGGCTGCCTCGGGGAAGTGG + Intronic
1182431416 22:30301168-30301190 AGTGGGCTCCTCCTGGGCTTGGG + Intronic
1183544248 22:38447268-38447290 AGTGGGCTTCCCCGGAGATGGGG + Intronic
1184229486 22:43151120-43151142 ACTGGGGTGCTCCGGAAATGGGG + Intergenic
1184248320 22:43246728-43246750 CGTGGGCTGCCCCGGAGATGTGG + Intronic
1184866649 22:47205265-47205287 AGAGGGCTGCTCCAGGCTTGGGG - Intergenic
1185319684 22:50194800-50194822 GGCTGGCTGCTCCTGGGATGGGG + Intronic
953119689 3:40027533-40027555 AGAGGGCTTCTCTGGGGAAGTGG - Intronic
953916163 3:46922424-46922446 AGGGGGCTGCCCTGGGGAAGAGG + Intronic
954581943 3:51707670-51707692 ACTGGGCTCCTCTGGGGATCAGG - Intronic
955327639 3:58021413-58021435 AATGTGCTGCTGCTGGGATGGGG + Intronic
957590195 3:82186471-82186493 AGTGGGCAGCTCCAAGGAGGTGG - Intergenic
960944792 3:122958488-122958510 AGTGGGCTTCTCCGTGGGGGTGG + Intronic
961664174 3:128486102-128486124 AGTGGGCTGCTGTAGGGGTGAGG + Exonic
962063973 3:131959773-131959795 AGTGGGCAGCTCAGGGAGTGGGG - Intronic
962411224 3:135143299-135143321 GGTGGGCTGCTCTGAGGAGGAGG + Intronic
962608176 3:137050108-137050130 AGAGGGATGATCCAGGGATGTGG + Intergenic
965610180 3:170535543-170535565 AGTGGGCTGCTGGGTGGATCTGG - Intronic
967123892 3:186407520-186407542 AGTTGACTGCCCCTGGGATGGGG - Intergenic
967307091 3:188069666-188069688 TGTGATCTGCTCTGGGGATGAGG - Intergenic
968516058 4:1016117-1016139 CCTGGGCTGCTCCGTGGTTGGGG + Intronic
968525997 4:1057473-1057495 TGTGGTCTGTTCCGGGGCTGGGG + Intronic
968541768 4:1171683-1171705 GGTGTGCGGTTCCGGGGATGCGG - Intronic
970141637 4:12989323-12989345 AGTGGCCGGCGGCGGGGATGGGG + Intergenic
972356228 4:38281454-38281476 TGTGGGTTGCTCTGGAGATGTGG + Intergenic
972963490 4:44482064-44482086 CGTGGGGTGTTGCGGGGATGAGG - Intergenic
973531929 4:51843613-51843635 AGCGGGCAGGGCCGGGGATGTGG + Intronic
974894788 4:67926529-67926551 AGTCGGCTGCCTCAGGGATGTGG - Intronic
975131939 4:70839781-70839803 GGGGCGCTGCTCCGGGGCTGCGG - Exonic
983157510 4:164369094-164369116 AGTGGGCTGCTCCGGGGATGAGG + Intronic
986608476 5:9545699-9545721 AGGGGGCGGCTCTGGGGAAGTGG - Exonic
987147726 5:15008782-15008804 AGTGGCCTGCTGCAGTGATGTGG + Intergenic
987785538 5:22493949-22493971 AGTGGGATGGTCCAGGGTTGGGG + Intronic
987905399 5:24069705-24069727 TGTGGGCTGCTCCCATGATGAGG - Intronic
991967347 5:72106834-72106856 AGTGGGCAGATGCGGGGCTGTGG - Intergenic
992679386 5:79138914-79138936 ACTGGGCTGCTCCTTGGGTGTGG - Intronic
993187281 5:84636016-84636038 AGTTGGCTGCCTCGGGGATGTGG + Intergenic
993725359 5:91360727-91360749 ATTGGGCCGCTTAGGGGATGTGG + Intergenic
994067209 5:95556517-95556539 TGTGGGCTGCTCCTAGAATGGGG + Intronic
995869342 5:116727880-116727902 AGTGGGCTTCTCCTGGGTTTGGG + Intergenic
997695258 5:135856467-135856489 CCTGGGCAGCTCCGGGGCTGGGG - Intronic
997733116 5:136194812-136194834 AGTGGGCCACTCAGGAGATGGGG + Intergenic
997766163 5:136505876-136505898 AGGTGGCTGCTCCTGGAATGAGG - Intergenic
999732333 5:154484005-154484027 ACCGAGCTGCTTCGGGGATGGGG - Intergenic
1001399724 5:171439321-171439343 AGTGGGCCGCTCCAGGAATAAGG + Intronic
1001623899 5:173113749-173113771 AGTAGGCTGCTCATGGGAGGAGG + Intronic
1002465829 5:179407988-179408010 AGGCGGCAGCTCCGGGTATGTGG - Intergenic
1002567215 5:180118889-180118911 AGAGGGCTGCTCCTGGGACAGGG + Intronic
1002885507 6:1290227-1290249 ATTGGGCTGCTGTGAGGATGAGG - Intergenic
1003389580 6:5701836-5701858 AATGGGCTGCTCGTGGCATGTGG + Intronic
1004162148 6:13223946-13223968 AGTGGTGTGCTGCAGGGATGTGG - Intronic
1006098561 6:31671354-31671376 TCAGGGCTGCTCCGGGCATGGGG + Intronic
1006386364 6:33733283-33733305 AGGGGGCTGGCCCTGGGATGGGG + Intronic
1006450718 6:34104257-34104279 GGTGGGCTTCCCCGGGGCTGGGG + Intronic
1011795341 6:90947150-90947172 AGTCAGCTGCATCGGGGATGTGG - Intergenic
1012522351 6:100136507-100136529 TGTGGGACGCTCCGTGGATGAGG + Intergenic
1013984474 6:116173565-116173587 AGTGTGCTCCTCAGGGTATGAGG + Intronic
1014221694 6:118804743-118804765 TGTGGGCTGCCCTGGGGAAGGGG - Intergenic
1017258761 6:152363637-152363659 AGTGGTGTGATCCGGGGGTGTGG - Intronic
1017302215 6:152875038-152875060 TGTGGGCTGCTCTGGGAATAGGG + Intergenic
1019193645 6:170268582-170268604 TGGGGGCTGTTCCGGGTATGGGG - Intergenic
1019355503 7:576771-576793 AGTGGGAAGCACCGGGAATGAGG + Intronic
1019417571 7:934463-934485 TGGGGGCTGCTGTGGGGATGGGG - Intronic
1019774178 7:2902517-2902539 AGGGGGCTGCTTTGGGGAGGGGG - Intergenic
1019835488 7:3378929-3378951 AGGGGTCTGCTCCGGGGAAGGGG - Intronic
1022537846 7:31108983-31109005 AGGGGGCTGCTCCTTGGATCTGG - Exonic
1022885953 7:34643865-34643887 AGTCGGCTGTTGCTGGGATGTGG - Intergenic
1024227004 7:47333061-47333083 GCTGGCCTGCTCCGCGGATGAGG + Intronic
1024519297 7:50290041-50290063 AGTGGGCAGGGCAGGGGATGGGG - Intergenic
1027422806 7:78033781-78033803 AGTGGGCTGCTGTGGGAAGGGGG + Intronic
1029402186 7:100353278-100353300 GGGGGGCTGCTTTGGGGATGAGG + Intronic
1034943135 7:155244904-155244926 AGGGTGCTGCGCTGGGGATGGGG - Intergenic
1035271363 7:157722029-157722051 TGGTGGCTGCTCCGGGGGTGGGG - Intronic
1035621784 8:1040886-1040908 AGAGGGCAGCTCCAGGAATGAGG - Intergenic
1035662183 8:1356456-1356478 AGTGGGCGTCTCCAGGGCTGCGG + Intergenic
1037825991 8:22160965-22160987 AGTGAGCTGATTCGAGGATGGGG + Intronic
1038447307 8:27612915-27612937 AAGGGGCTGCTCAGGGGAAGAGG + Intronic
1040661552 8:49582171-49582193 AGTCGGCTGCTTCCGGGACGCGG - Intergenic
1042004719 8:64168603-64168625 AGTCGGCTGCCTCAGGGATGTGG - Intergenic
1042340256 8:67671354-67671376 AGTGGGCTGCAGTGGGGATGGGG - Intronic
1042648105 8:71009638-71009660 AGTGGGGAGCTGAGGGGATGGGG + Intergenic
1043745373 8:83868772-83868794 AGTTGGCTGCCTTGGGGATGTGG - Intergenic
1045003283 8:97896548-97896570 AGTGGGCTGGGCAGGGGATCAGG + Intronic
1046285539 8:112088525-112088547 AGTGGTTTCCTCCGGGGAGGAGG + Intergenic
1048991782 8:139764777-139764799 AGTGGGCAGCTCAGGGGTAGGGG - Intronic
1049077041 8:140406519-140406541 AGTGAGCTGCACAGGGGATGAGG - Intronic
1049286988 8:141781151-141781173 GCTGGGCTGCCCTGGGGATGTGG - Intergenic
1050550474 9:6744767-6744789 AGTGGTGTGCTCCAGGGTTGTGG + Intronic
1051242895 9:15079102-15079124 AGTGGGCTTCTGAGGGAATGTGG + Intergenic
1053122146 9:35555450-35555472 TGTGGGCTGCTCTGGGGGAGGGG - Exonic
1053307865 9:36996600-36996622 TGTCTGCTGCTCCCGGGATGAGG - Intronic
1055528228 9:77156662-77156684 TGTGGGCTGCTCCTGGGGAGGGG + Intergenic
1057826367 9:98375313-98375335 AGTGGGCTTCTCAGAGGAAGTGG - Intronic
1059415931 9:114162545-114162567 AGTGGGCTGCTGCTCTGATGGGG + Intronic
1060199022 9:121641046-121641068 AGAGAGCTCCTCCTGGGATGGGG + Intronic
1060263101 9:122092936-122092958 ACTGGGCTGCGCCGGGGCCGGGG + Exonic
1060829761 9:126706117-126706139 AGGTGGCAGCTCAGGGGATGGGG - Intergenic
1061163060 9:128906997-128907019 AGTGGGCTGCCCCGTGGAGTAGG + Intronic
1061418546 9:130461268-130461290 TGTGGGCTGGTCCGGGGTGGGGG - Intronic
1061595082 9:131623748-131623770 ATGGGGCTGCTCCGGGCAAGAGG + Intronic
1062033915 9:134374361-134374383 TGTGGGCTGCTCCCGGCCTGAGG + Intronic
1062068875 9:134544580-134544602 AGTGGGCTGCCCTGGAGGTGGGG + Intergenic
1062112726 9:134790828-134790850 GGTGGGCTGCTCCTGTGCTGGGG + Intronic
1062327413 9:136018807-136018829 AGCAGGCTGCACCGGGGGTGGGG - Intronic
1062361463 9:136190231-136190253 AGAGGGCTGACCCTGGGATGAGG - Intergenic
1062460579 9:136661038-136661060 AGAGGGCACCTCCTGGGATGGGG + Intronic
1062688516 9:137828563-137828585 AGTGTGCTCCTGCGGGGGTGCGG + Intronic
1062718318 9:138022322-138022344 AGGGGGCAGCTGCGGGGCTGCGG + Intronic
1187027226 X:15448141-15448163 AGTGGGCTGCCCTGGGCAAGAGG + Intronic
1188971848 X:36627436-36627458 AGTGGGGAGCTGGGGGGATGTGG - Intergenic
1190641972 X:52488623-52488645 AGTGGGGAGCTTGGGGGATGTGG - Intergenic
1190645700 X:52524243-52524265 AGTGGGGAGCTTGGGGGATGTGG + Intergenic
1199188230 X:144940421-144940443 AGTCGGCTGCCTCAGGGATGCGG + Intergenic