ID: 983162951

View in Genome Browser
Species Human (GRCh38)
Location 4:164439885-164439907
Sequence CTCACAGAGAAGTCTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983162947_983162951 21 Left 983162947 4:164439841-164439863 CCCAGAATAACAGTGGTTTAAAT No data
Right 983162951 4:164439885-164439907 CTCACAGAGAAGTCTGGAGAGGG No data
983162948_983162951 20 Left 983162948 4:164439842-164439864 CCAGAATAACAGTGGTTTAAATA No data
Right 983162951 4:164439885-164439907 CTCACAGAGAAGTCTGGAGAGGG No data
983162946_983162951 27 Left 983162946 4:164439835-164439857 CCAAGGCCCAGAATAACAGTGGT No data
Right 983162951 4:164439885-164439907 CTCACAGAGAAGTCTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983162951 Original CRISPR CTCACAGAGAAGTCTGGAGA GGG Intergenic
No off target data available for this crispr