ID: 983165003

View in Genome Browser
Species Human (GRCh38)
Location 4:164464719-164464741
Sequence TAGTGTTTCCATAAGAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983165003_983165007 16 Left 983165003 4:164464719-164464741 CCCATCTTCTTATGGAAACACTA No data
Right 983165007 4:164464758-164464780 GCCCAGAGGCAGACAAAATAGGG No data
983165003_983165011 30 Left 983165003 4:164464719-164464741 CCCATCTTCTTATGGAAACACTA No data
Right 983165011 4:164464772-164464794 AAAATAGGGAGGAGAAATAAAGG No data
983165003_983165010 19 Left 983165003 4:164464719-164464741 CCCATCTTCTTATGGAAACACTA No data
Right 983165010 4:164464761-164464783 CAGAGGCAGACAAAATAGGGAGG No data
983165003_983165005 2 Left 983165003 4:164464719-164464741 CCCATCTTCTTATGGAAACACTA No data
Right 983165005 4:164464744-164464766 GAGCTGTAAAAATAGCCCAGAGG No data
983165003_983165006 15 Left 983165003 4:164464719-164464741 CCCATCTTCTTATGGAAACACTA No data
Right 983165006 4:164464757-164464779 AGCCCAGAGGCAGACAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983165003 Original CRISPR TAGTGTTTCCATAAGAAGAT GGG (reversed) Intergenic
No off target data available for this crispr