ID: 983167981

View in Genome Browser
Species Human (GRCh38)
Location 4:164500623-164500645
Sequence CTAACAGCCCAGTTATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983167981_983167985 19 Left 983167981 4:164500623-164500645 CCTCCAAATAACTGGGCTGTTAG No data
Right 983167985 4:164500665-164500687 AATGTATAAATCAAGTAAAGGGG No data
983167981_983167983 17 Left 983167981 4:164500623-164500645 CCTCCAAATAACTGGGCTGTTAG No data
Right 983167983 4:164500663-164500685 TCAATGTATAAATCAAGTAAAGG No data
983167981_983167984 18 Left 983167981 4:164500623-164500645 CCTCCAAATAACTGGGCTGTTAG No data
Right 983167984 4:164500664-164500686 CAATGTATAAATCAAGTAAAGGG No data
983167981_983167986 24 Left 983167981 4:164500623-164500645 CCTCCAAATAACTGGGCTGTTAG No data
Right 983167986 4:164500670-164500692 ATAAATCAAGTAAAGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983167981 Original CRISPR CTAACAGCCCAGTTATTTGG AGG (reversed) Intergenic
No off target data available for this crispr