ID: 983167985

View in Genome Browser
Species Human (GRCh38)
Location 4:164500665-164500687
Sequence AATGTATAAATCAAGTAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983167980_983167985 20 Left 983167980 4:164500622-164500644 CCCTCCAAATAACTGGGCTGTTA No data
Right 983167985 4:164500665-164500687 AATGTATAAATCAAGTAAAGGGG No data
983167982_983167985 16 Left 983167982 4:164500626-164500648 CCAAATAACTGGGCTGTTAGTGC No data
Right 983167985 4:164500665-164500687 AATGTATAAATCAAGTAAAGGGG No data
983167981_983167985 19 Left 983167981 4:164500623-164500645 CCTCCAAATAACTGGGCTGTTAG No data
Right 983167985 4:164500665-164500687 AATGTATAAATCAAGTAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983167985 Original CRISPR AATGTATAAATCAAGTAAAG GGG Intergenic
No off target data available for this crispr