ID: 983176456

View in Genome Browser
Species Human (GRCh38)
Location 4:164594052-164594074
Sequence AGTCAACTCCATCACTCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983176455_983176456 -8 Left 983176455 4:164594037-164594059 CCGCATAGCTAAGATAGTCAACT No data
Right 983176456 4:164594052-164594074 AGTCAACTCCATCACTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983176456 Original CRISPR AGTCAACTCCATCACTCAAA TGG Intergenic
No off target data available for this crispr