ID: 983181660

View in Genome Browser
Species Human (GRCh38)
Location 4:164655936-164655958
Sequence TCCTTCCCAGGATGTATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983181660_983181671 24 Left 983181660 4:164655936-164655958 CCCTACATACATCCTGGGAAGGA No data
Right 983181671 4:164655983-164656005 CCAACCATGGTTAAAGTGACTGG No data
983181660_983181673 29 Left 983181660 4:164655936-164655958 CCCTACATACATCCTGGGAAGGA No data
Right 983181673 4:164655988-164656010 CATGGTTAAAGTGACTGGAGTGG No data
983181660_983181667 11 Left 983181660 4:164655936-164655958 CCCTACATACATCCTGGGAAGGA No data
Right 983181667 4:164655970-164655992 CATTTTATCTACCCCAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983181660 Original CRISPR TCCTTCCCAGGATGTATGTA GGG (reversed) Intergenic
No off target data available for this crispr