ID: 983195446

View in Genome Browser
Species Human (GRCh38)
Location 4:164801241-164801263
Sequence CTGTGGATAAGTAGTTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983195446_983195451 -6 Left 983195446 4:164801241-164801263 CCATGGGAACTACTTATCCACAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 983195451 4:164801258-164801280 CCACAGTTACACAAGAGGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 178
983195446_983195449 -7 Left 983195446 4:164801241-164801263 CCATGGGAACTACTTATCCACAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 983195449 4:164801257-164801279 TCCACAGTTACACAAGAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 166
983195446_983195448 -8 Left 983195446 4:164801241-164801263 CCATGGGAACTACTTATCCACAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 983195448 4:164801256-164801278 ATCCACAGTTACACAAGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983195446 Original CRISPR CTGTGGATAAGTAGTTCCCA TGG (reversed) Intergenic
905243468 1:36596384-36596406 CTGTTTTTAAGTACTTCCCAGGG - Intergenic
906818443 1:48903451-48903473 CAGTGGATAGGCAGATCCCAGGG - Intronic
910934824 1:92479216-92479238 GTGTGGATATGTATTTGCCATGG - Intronic
920009215 1:202855626-202855648 CTGTGGAGAAGTGGTGCCCAAGG - Intergenic
923959653 1:239063303-239063325 TTATGGATAAGTAGTTCTCTGGG + Intergenic
1064909548 10:20385045-20385067 CTGTTGAAATGTAGTCCCCAAGG + Intergenic
1067576311 10:47410821-47410843 ATGTGGCTCAGTAGTTCCCTGGG + Intergenic
1068391940 10:56409081-56409103 CTGAGGATAAGTAGCTCAAATGG - Intergenic
1070367823 10:75753252-75753274 CTGAGAATAAGTAGTACCTAAGG + Intronic
1075216174 10:120538160-120538182 GTCTGGATAAGTCATTCCCATGG + Intronic
1075829848 10:125399425-125399447 ATTTGGATAAGTACTTGCCAGGG - Intergenic
1080850387 11:36063429-36063451 AAGTGGATTAGTGGTTCCCAGGG - Intronic
1085325851 11:75606131-75606153 CAGTGCATAAGGTGTTCCCAAGG + Intronic
1091692924 12:2609361-2609383 CTGTGAATAAGGAGTGCCCACGG + Intronic
1098286773 12:68915106-68915128 CTATGGAAACATAGTTCCCATGG + Intronic
1104274765 12:127316371-127316393 ATGTAGATTAGTGGTTCCCATGG + Intergenic
1105730545 13:23211241-23211263 CCGTGGGTAAGTAGATCCCTGGG + Intronic
1108261399 13:48660286-48660308 CTGGGGATAAGTTGTTCTCTGGG + Intronic
1109392125 13:61707055-61707077 TTGAGGATAATTAGATCCCAGGG + Intergenic
1118120209 14:62831252-62831274 GTTTGGATAGGTATTTCCCAAGG + Intronic
1120056386 14:79929260-79929282 ATGAGGATAACTAGGTCCCAGGG - Intergenic
1121329471 14:93040872-93040894 GTGAGGTGAAGTAGTTCCCAGGG - Intronic
1121371132 14:93359474-93359496 ATGGGGATAATTAGATCCCATGG + Intronic
1125708782 15:41766631-41766653 CTATGGATACAGAGTTCCCAGGG + Exonic
1127346801 15:58109202-58109224 CTGTGCAGAACAAGTTCCCATGG + Intronic
1133420176 16:5639333-5639355 CTGTGGATGAGATGTTGCCAAGG - Intergenic
1133837313 16:9378517-9378539 CTGTGGATAAAGAGTTAACAAGG + Intergenic
1134271649 16:12737996-12738018 CTGGGGATAAGTGGTTAACACGG + Intronic
1139588820 16:67921626-67921648 CTGAGGCCAAGTGGTTCCCAGGG - Intronic
1143670993 17:8395987-8396009 TTGGGGATAAGTAGTGGCCAAGG + Intronic
1144646294 17:16976254-16976276 CTGTTGATCAATATTTCCCAGGG + Intergenic
1153221938 18:2869440-2869462 AAGTGGATCAGCAGTTCCCAGGG - Intronic
1154072980 18:11171218-11171240 ATGTAAATTAGTAGTTCCCAGGG + Intergenic
1157617268 18:48994695-48994717 TTGTGTAGAAATAGTTCCCAGGG + Intergenic
1158043095 18:53121238-53121260 CTGGGGATACGTATTTCCAAAGG + Intronic
1159867500 18:73723701-73723723 ATGTGGATAATTTGTTTCCAAGG + Intergenic
1161760597 19:6168265-6168287 GTGTGGAAAAATACTTCCCACGG - Intronic
1161844308 19:6703193-6703215 TTATGGAGAAGAAGTTCCCAAGG - Intronic
1162407815 19:10486246-10486268 CTCTGGAAATGTGGTTCCCAGGG - Exonic
1165654322 19:37520161-37520183 CTGAAGATAAGCAGATCCCATGG - Intronic
1166161218 19:40954874-40954896 CTGTGGATAAGTAGTGTGCTTGG + Intergenic
925847843 2:8049815-8049837 CTTTGGATGAATGGTTCCCAAGG - Intergenic
925852640 2:8097888-8097910 AAGTGGATTAGTAGTTTCCAGGG + Intergenic
929071675 2:38037854-38037876 CTGAGGTTAAGTAGCTCACACGG + Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
932638231 2:73412271-73412293 AATTGGATAAGTAGTTGCCAGGG - Intronic
933818214 2:86086030-86086052 CTGTGCCTGAGTAGTCCCCATGG - Intronic
939941475 2:148356777-148356799 CTCTGGAAGAGCAGTTCCCAAGG - Intronic
940067378 2:149645184-149645206 CTGTGGATAAGAAGCTCAAAGGG - Intergenic
941723411 2:168836354-168836376 CTGTGGATCTTTACTTCCCAGGG - Intronic
943521207 2:188951012-188951034 ATGTGGATAAATAGTACTCATGG - Intergenic
1169330409 20:4711720-4711742 CTGTGGATTAGTGGTTGCCGGGG + Intergenic
1171289085 20:23969957-23969979 CAGTGGATAACTAGTACACAAGG + Intergenic
1172998033 20:39084923-39084945 CTGTTTATAAGGAGTGCCCAGGG - Intergenic
1174314699 20:49689395-49689417 CTGTGAAATTGTAGTTCCCACGG - Intronic
950930349 3:16783204-16783226 GTGAGGAGAAGTAGTTCCCAGGG + Intergenic
951184588 3:19698055-19698077 CTGTGGAATAGTGGTTTCCAGGG + Intergenic
951319434 3:21226610-21226632 TTTTGAATAAGCAGTTCCCAAGG - Intergenic
955187880 3:56732491-56732513 CTGTGGATAAAGAGGTCCCCAGG + Intronic
959514530 3:107250257-107250279 CTGTGGAAAACTAGTTCCATAGG + Intergenic
959955245 3:112230276-112230298 CTGTTCATAGGCAGTTCCCAGGG + Intronic
960848286 3:122024479-122024501 AACTGGATAAGTAATTCCCAAGG - Intergenic
961751200 3:129095828-129095850 CTGTGGAGAAGAGGTGCCCATGG + Intronic
963580697 3:147123158-147123180 CTGTGCTTAAGTAGATACCAAGG + Intergenic
966553994 3:181237870-181237892 TTGTGGATATCTAATTCCCATGG + Intergenic
966711631 3:182978978-182979000 CTGTGGCTGAGTGTTTCCCAGGG + Intronic
966745387 3:183270187-183270209 CAGTGGATTAGGAGTTCCTAAGG - Exonic
969620668 4:8277263-8277285 CTGGGTCTAACTAGTTCCCAGGG - Intronic
976621783 4:87135725-87135747 ATGTGCAAAAATAGTTCCCAAGG - Exonic
977338066 4:95722862-95722884 CTGGAGAAAAGTAGTTCGCAAGG - Intergenic
980011585 4:127601066-127601088 AAGTGGATAAGTAGGTCACAGGG - Intergenic
980657452 4:135808177-135808199 TTGTGGTTAAGTTGTTTCCAGGG + Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
984517460 4:180758107-180758129 CAGTGGGTCAGAAGTTCCCAAGG + Intergenic
986387125 5:7245568-7245590 AGGTGGAAAAGTAGTTACCAGGG - Intergenic
988540798 5:32107259-32107281 CTGTAAGTAAGTAGTCCCCATGG + Intronic
992584717 5:78225270-78225292 CTGTGGCTAAGTGGTTAACATGG - Intronic
993837722 5:92835451-92835473 CTGTGGATCAGGAGATCCCCTGG - Intergenic
996486755 5:124044266-124044288 CTTTGGATAATAAGTTCCTAGGG - Intergenic
1003026959 6:2563688-2563710 CTGTGGATCTGGAGCTCCCATGG - Intergenic
1003566438 6:7226717-7226739 CTGAGGAGAGGAAGTTCCCATGG - Intronic
1009355077 6:62733523-62733545 CTGTGGACAAGGAGATCCAATGG - Intergenic
1009641664 6:66345345-66345367 CTGTGATTCTGTAGTTCCCATGG + Intergenic
1011151488 6:84278519-84278541 CTGTGGAAATGTACTTCACAGGG - Intergenic
1014659340 6:124148423-124148445 CTGTAAATCAGTAGTTGCCAGGG - Intronic
1019655516 7:2192611-2192633 CTGTGGAGAATCAGTTCCCTAGG - Intronic
1021443565 7:20708186-20708208 CTGTGGAAAAGTCATTTCCATGG - Intronic
1023221723 7:37926103-37926125 CTGTGGATGATTAATTCCCAGGG + Intronic
1023510317 7:40945696-40945718 ATGTGGATTATTTGTTCCCATGG + Intergenic
1029319035 7:99741149-99741171 CCCTGGATAAGTACTGCCCAGGG - Intergenic
1031772314 7:125859895-125859917 CTTTGGATATGTATTCCCCATGG - Intergenic
1033605080 7:142921128-142921150 GTGTGGACAAATAGATCCCACGG + Intronic
1034190449 7:149209381-149209403 CAGTCGATTAGTGGTTCCCAGGG - Intronic
1037012294 8:13858716-13858738 CAGTAGATTAGTAGTTGCCAAGG + Intergenic
1040561869 8:48529610-48529632 CTGTGTTTAAGATGTTCCCATGG + Intergenic
1040809236 8:51432190-51432212 CTGTGGATAATGAGTTGCCCAGG + Intronic
1042057285 8:64778618-64778640 CTGTCTATAATTAATTCCCAGGG + Intronic
1042366126 8:67938906-67938928 CAGTGGCTAAGTAGTTCTCTGGG - Intergenic
1043408849 8:79970631-79970653 CTGTGGTTCAGTAGTGCACAAGG - Intronic
1046924926 8:119775843-119775865 AGGTGGCTAAGTAGTTCCCAGGG - Intronic
1051379726 9:16443810-16443832 AAGTGGATTAGTAGTTGCCAGGG + Intronic
1186400549 X:9254942-9254964 CTGGGAATAAGCAGTTTCCAAGG - Intergenic
1186430859 X:9503266-9503288 CTGTGGAAAAGCAGTTTCCCCGG - Intronic
1189904108 X:45740246-45740268 CAGTAGATAAGTAGTTGCCGGGG - Intergenic
1195080890 X:101369183-101369205 TTGTGGATAAATATTTCCCAAGG - Intronic
1196465956 X:115971605-115971627 TAGTGGATTAGTAGTTGCCAGGG + Intergenic
1198039190 X:132832988-132833010 AAGTGGATTAGTAGTTGCCAGGG - Intronic
1202037037 Y:20646256-20646278 CTGTGGCTAAGTGGTGGCCAAGG + Intergenic