ID: 983195451

View in Genome Browser
Species Human (GRCh38)
Location 4:164801258-164801280
Sequence CCACAGTTACACAAGAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983195442_983195451 29 Left 983195442 4:164801206-164801228 CCGATATTTCTCGCTAAGAAGAC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 983195451 4:164801258-164801280 CCACAGTTACACAAGAGGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 178
983195446_983195451 -6 Left 983195446 4:164801241-164801263 CCATGGGAACTACTTATCCACAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 983195451 4:164801258-164801280 CCACAGTTACACAAGAGGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983195451 Original CRISPR CCACAGTTACACAAGAGGAG GGG Intergenic
900354520 1:2253821-2253843 CCACAGTGACAGCAGAGGGGAGG + Intronic
901804449 1:11729336-11729358 TCCCAGTTACGCAAGAGGAGGGG - Intergenic
902114775 1:14112412-14112434 CCACAGTGGCCAAAGAGGAGTGG - Intergenic
902723031 1:18316669-18316691 CCAGAGTTACACAAAAAGAATGG - Intronic
903319943 1:22536920-22536942 CCACAGTCACACATGACTAGTGG - Intergenic
905148601 1:35907978-35908000 CCACAGGTGCACAAGATGACTGG - Intronic
905858934 1:41333426-41333448 CCACAGTCACAGGAGTGGAGGGG - Intergenic
907588261 1:55641024-55641046 CCACTGTGCCACAGGAGGAGAGG + Intergenic
909089082 1:71203707-71203729 CCCCAGTTACACACAAAGAGTGG - Intergenic
911232708 1:95377826-95377848 CCATTGTTACAGAAGTGGAGAGG + Intergenic
911592286 1:99762018-99762040 CCAAAGTTACAGAAAATGAGAGG + Intronic
911706974 1:101025543-101025565 CCAAAGTAGCACAAGAGAAGAGG + Intronic
915081943 1:153358590-153358612 TCACAGTTACACAGGACGACAGG + Intronic
916336011 1:163671950-163671972 ACACAGACACACATGAGGAGTGG + Intergenic
916714894 1:167440272-167440294 CCCCAGTTACAGATGAGGAAAGG + Intronic
917045301 1:170853037-170853059 CCAAAGTTGCACATGAAGAGGGG + Intergenic
918789351 1:188806087-188806109 CTATAGTTTCACAAAAGGAGTGG + Intergenic
920266276 1:204725820-204725842 AGACAGTCACACAAGGGGAGGGG - Intergenic
920534742 1:206730151-206730173 CCCCAGATAGCCAAGAGGAGGGG - Intronic
921283650 1:213590278-213590300 CCACATTTACTCTTGAGGAGTGG + Intergenic
921931849 1:220761306-220761328 GGACACTTTCACAAGAGGAGAGG - Intronic
923070332 1:230558534-230558556 GCCCATTTACCCAAGAGGAGTGG - Intergenic
923126400 1:231038387-231038409 CCACAGCTTCACAACAGGAGCGG + Intronic
923737241 1:236622138-236622160 CCACATACACTCAAGAGGAGGGG - Intergenic
923933135 1:238726507-238726529 CCTCAGTGACACCAGAGGAAGGG + Intergenic
1065939671 10:30552950-30552972 ACACAGACACACATGAGGAGTGG - Intergenic
1067951330 10:50740471-50740493 CCACAGACACACAACACGAGCGG - Intronic
1069098214 10:64286446-64286468 CCACTGTAACAGAAGAGGAGAGG - Intergenic
1069905197 10:71728117-71728139 GCACAGTTTTGCAAGAGGAGTGG + Intronic
1072250800 10:93581020-93581042 CCACTGTTACAAAAGGGTAGAGG - Intronic
1076594087 10:131614408-131614430 GCACAGTTACAGAATGGGAGAGG - Intergenic
1080153113 11:29076678-29076700 CCACAGGGATACAACAGGAGAGG - Intergenic
1080219419 11:29883117-29883139 CCACAGTGTCAGAAGAAGAGGGG + Intergenic
1084802371 11:71553526-71553548 CCCCAGTTCCACAAGAGAGGTGG - Intronic
1085637631 11:78170647-78170669 CCACAGCTGCACAAGGGGAAGGG - Intergenic
1085951618 11:81339261-81339283 CCACAGTTCAAGAAGAGGAGGGG - Intergenic
1089219329 11:116857926-116857948 CCACCGGTACTCAAGAGCAGAGG + Exonic
1089712347 11:120325077-120325099 CAACAGCTAAACAAGAGCAGCGG + Intergenic
1090773975 11:129947135-129947157 CCACACTTACACAAGTCGTGTGG + Exonic
1090908510 11:131097772-131097794 CCCCAGTTACAGATGAGGAAGGG + Intergenic
1091297979 11:134487049-134487071 CCACAGATACAGACCAGGAGGGG - Intergenic
1092594431 12:9985998-9986020 CTACTGTCACAGAAGAGGAGGGG - Intronic
1092863281 12:12738148-12738170 CCACTCCTACACATGAGGAGAGG + Intronic
1094055572 12:26266186-26266208 GAACAGATACAGAAGAGGAGAGG + Intronic
1102312441 12:111856712-111856734 CAACAGTAACACAAAAGAAGAGG - Intronic
1103619260 12:122176340-122176362 CCACAGTGACGCGAGAGGACAGG + Intronic
1107067682 13:36232948-36232970 CCACAGTTACACATGTGTATGGG - Intronic
1112121951 13:96422708-96422730 CCTCATTTACAGGAGAGGAGTGG - Intronic
1112595829 13:100806072-100806094 CCTCAGAGACACAAGGGGAGAGG - Intergenic
1114490012 14:23094682-23094704 CCACAGATACAAACAAGGAGGGG + Intronic
1115149826 14:30271504-30271526 AGACAGTTACAAAAGGGGAGGGG + Intergenic
1116870700 14:50066967-50066989 CCACAGCTCCCCAAGAGGAAGGG + Intergenic
1120275411 14:82367209-82367231 GCAGAGTTTCACAATAGGAGAGG + Intergenic
1123925428 15:25104970-25104992 ACAGAATTACACAAGAGTAGAGG + Intergenic
1126844431 15:52745812-52745834 ACACAGTCACACACAAGGAGTGG - Intergenic
1129544424 15:76379835-76379857 CCACAAGTTCACAGGAGGAGAGG + Intronic
1131351912 15:91708890-91708912 CCACAGATACACAAGGGAATGGG - Intergenic
1133589240 16:7226726-7226748 TCACAGTTAATCAAGAGGACTGG + Intronic
1134024443 16:10943140-10943162 CAACGGTTACCCAAGAGCAGGGG - Intergenic
1135833867 16:25805205-25805227 CCACAGATACACTTGAGGAGGGG + Intronic
1138686323 16:58729098-58729120 CCACAGCAACACAAAATGAGAGG - Intronic
1139673806 16:68509501-68509523 TCACAGTTACCCAAGATGAAGGG - Intergenic
1141527305 16:84619513-84619535 ACACAGTTTCAGAAGAGTAGAGG + Intergenic
1143797204 17:9346726-9346748 CCACAGTGACACCATAGGGGTGG + Intronic
1146224271 17:31052164-31052186 CAAAAGTTGGACAAGAGGAGAGG - Intergenic
1150576850 17:66438151-66438173 CCGCAGTCACACAAGATGAAGGG - Intronic
1151264457 17:72943700-72943722 CCACAGATACACAAAATGATAGG + Intronic
1152885080 17:82844974-82844996 GCAGAGTTACACCAGAGGTGGGG + Intronic
1154299906 18:13184008-13184030 CCACAGTTACACAGGCAGTGAGG - Intergenic
1155794006 18:30010833-30010855 CCACAGTTGGAAAAGAGTAGAGG - Intergenic
1157829064 18:50840017-50840039 CCACAGATACATCAGAGGTGGGG + Intergenic
1159409142 18:68048218-68048240 CCATTGTTTCACAAGAAGAGAGG + Intergenic
1160276778 18:77444464-77444486 TCACAGTTGCAAATGAGGAGTGG + Intergenic
1162910232 19:13844126-13844148 CCAGAGTTACTCAAAAGGGGAGG - Intergenic
1165755975 19:38293179-38293201 CCTCAGAGACACAGGAGGAGTGG + Intronic
1167508353 19:49882801-49882823 CTCCAGTTACAGAGGAGGAGTGG + Exonic
1168200589 19:54812636-54812658 CCACACTGACAGAAGAGAAGGGG + Intronic
925034370 2:674422-674444 ACACAGTGAAACAGGAGGAGCGG - Intronic
929172866 2:38948969-38948991 CTACAGGTACAAAAGAGGAGAGG - Intronic
931622326 2:64223402-64223424 CCAGAGTTACAGAGCAGGAGGGG - Intergenic
931781041 2:65579671-65579693 CCACACTGACCCAGGAGGAGGGG + Intergenic
932315711 2:70780788-70780810 CCACAGTGACCCAAGTGAAGTGG + Intronic
932637297 2:73402004-73402026 ACACACATACACACGAGGAGGGG - Intronic
933622048 2:84554335-84554357 CCACCCATACTCAAGAGGAGGGG + Intronic
935139209 2:100337130-100337152 ACACAGACACACATGAGGAGTGG - Intergenic
935650643 2:105378990-105379012 CCACAGTGATACAAGAGATGTGG - Intronic
935827268 2:106964120-106964142 CCACAGTGAGACAGAAGGAGAGG + Intergenic
936053056 2:109240139-109240161 CCATGGTTCCACAAGAAGAGAGG - Intronic
939719093 2:145625053-145625075 CCAAATATACAGAAGAGGAGGGG - Intergenic
940724152 2:157315818-157315840 ACACAGACACACATGAGGAGTGG + Intergenic
940792884 2:158046748-158046770 TCACAATTACATAAGTGGAGAGG - Intronic
1170262513 20:14426153-14426175 ACAAAGATAAACAAGAGGAGTGG - Intronic
1172808624 20:37631605-37631627 CCAGATTTACTCAAGGGGAGTGG - Intergenic
1172896667 20:38304971-38304993 CCACATTTACACGTGAGAAGTGG + Intronic
1173055405 20:39607380-39607402 ACACAGTTACTCAAGTCGAGAGG - Intergenic
1173882228 20:46424161-46424183 CTACAGTTAGACAAGAGCAAGGG - Intronic
1174539524 20:51277947-51277969 ACACACATACACAAGAGGACTGG - Intergenic
1175704378 20:61165323-61165345 CCACAGTGACACACGAGCTGCGG - Intergenic
1178343867 21:31808472-31808494 CCACGGTTAGACAGGGGGAGGGG - Intergenic
1181132912 22:20744226-20744248 CCAAAGTCGCACAAGTGGAGTGG - Intronic
1181361880 22:22343734-22343756 CCACAGTGACACAGGCAGAGGGG + Intergenic
1181406310 22:22687281-22687303 CCACAGTGACACAAGCAGACAGG + Intergenic
1181414256 22:22747921-22747943 CCACAGTGACACAAGGAGACAGG + Intronic
1181523168 22:23460791-23460813 CCACAGATACACAGGGCGAGTGG - Intergenic
1182495695 22:30705820-30705842 CCACTGTCACACAACTGGAGTGG + Intronic
1183054504 22:35295402-35295424 CCACAGATACAGAAGAGGCATGG - Exonic
949151163 3:768977-768999 TCACAGTGACACAACAGGATAGG + Intergenic
950003438 3:9675632-9675654 CCACTGTCAGGCAAGAGGAGAGG - Intronic
950528805 3:13540588-13540610 CCAGAGTTGCTCAAGAAGAGAGG + Intergenic
951459551 3:22935185-22935207 CCACAGTGACTCAACAGGAGGGG + Intergenic
953230183 3:41057937-41057959 CCACAGTTAGACAGGTGGGGAGG - Intergenic
956689606 3:71863801-71863823 TCATAGTTCCCCAAGAGGAGTGG + Intergenic
957693565 3:83602807-83602829 ACACAGATACAAAAGAGGATAGG - Intergenic
958434687 3:94082080-94082102 ACACAGTTATACAGAAGGAGCGG - Intronic
961053499 3:123767184-123767206 CCACTGTTAGACAAAAGCAGTGG + Intronic
961147817 3:124610292-124610314 TCACAGTTCCCCAAGAGGATGGG + Intronic
963055238 3:141181285-141181307 GCACAGGCACACAAGAAGAGGGG - Intergenic
963688206 3:148464761-148464783 CCACAGTTACACAACTAGTGTGG - Intergenic
964337303 3:155669096-155669118 CCACAGTTATGCCCGAGGAGTGG + Intronic
966219740 3:177539217-177539239 CCACAGTGACACGTGAGGGGTGG + Intergenic
969980837 4:11152428-11152450 CCACAGAAAGAAAAGAGGAGTGG - Intergenic
970492361 4:16587386-16587408 CCAAAGTCACACAAGAGCAAGGG + Intronic
970772887 4:19637414-19637436 CCACAATGACATAAGAGGTGAGG - Intergenic
971122337 4:23718571-23718593 CCCCAGGTACACATGAAGAGGGG - Intergenic
972661289 4:41119020-41119042 CCCCAGCTACTCAGGAGGAGGGG + Intronic
978184195 4:105837471-105837493 TCACAGTTCCCCAAGAAGAGGGG - Intronic
978624132 4:110665236-110665258 CTGCAGCTACACAATAGGAGTGG + Intergenic
982048915 4:151479654-151479676 GCACATTTATACAAGAGGTGTGG - Intronic
983195451 4:164801258-164801280 CCACAGTTACACAAGAGGAGGGG + Intergenic
983791589 4:171804769-171804791 CCACAGTTCTACAAGATGACAGG + Intergenic
984024529 4:174526994-174527016 GCAAAGATACTCAAGAGGAGCGG + Intergenic
985421136 4:189786226-189786248 CCGCAGTTTCACAAGCGGTGTGG + Intergenic
986445940 5:7821395-7821417 CCCCAGTTACAAAAGAGCAGTGG + Intronic
988396198 5:30700148-30700170 TCACAGTTCCACAGGAGGGGAGG - Intergenic
991303040 5:65147425-65147447 CATCAGTTACATAAGAAGAGTGG - Intergenic
992189137 5:74273525-74273547 CCACAATAACAAAAGAGGATAGG + Intergenic
996665612 5:126056852-126056874 ACACAGACACACACGAGGAGTGG + Intergenic
998627651 5:143863872-143863894 CCACAGTGTCACAGGTGGAGAGG + Intergenic
1002321853 5:178381098-178381120 CCACAGTCACTGAAGTGGAGTGG + Intronic
1003422294 6:5969342-5969364 CCTCATTTACAGAAAAGGAGAGG - Intergenic
1003655427 6:8002829-8002851 CCCCAGATACAGAAGAGAAGAGG + Intronic
1004737690 6:18424200-18424222 CCAGAGATACAGAAGAAGAGAGG + Intronic
1008356826 6:50564887-50564909 CTACAGTTACACTTGAAGAGTGG - Intergenic
1012711731 6:102615809-102615831 CCACAGGTTCACAGGAGTAGTGG - Intergenic
1012734440 6:102920995-102921017 ACACAGACACACAGGAGGAGTGG - Intergenic
1013796601 6:113895819-113895841 TCACTTTTACAGAAGAGGAGAGG - Intergenic
1015684396 6:135843270-135843292 GCTCAGTTACACAAGATGAAGGG + Intergenic
1016001618 6:139047568-139047590 CCAAAATTAGAAAAGAGGAGTGG + Intergenic
1016913688 6:149224644-149224666 CCACAGTGCCACAAGAGGTAAGG + Intronic
1018465432 6:164040072-164040094 CCACAGCCACAGGAGAGGAGAGG - Intergenic
1019588163 7:1815767-1815789 CCACAGATACACAGGGCGAGTGG + Intergenic
1019825795 7:3283197-3283219 GCACAGTTACACAAGTTAAGAGG - Intergenic
1020887395 7:13835121-13835143 CCAAAGTTAAACAACAGGAAGGG + Intergenic
1021528788 7:21619394-21619416 CCACAGTAAAACAGGAGGATTGG + Intronic
1032139474 7:129314218-129314240 CCATAGTTAGACTTGAGGAGAGG - Intronic
1033932934 7:146546678-146546700 TCACAGTTCCACATGAGGGGAGG + Intronic
1035309620 7:157957147-157957169 CCACTGTTACTCTAGAGCAGGGG + Intronic
1035380066 7:158432237-158432259 ACACAGTGACTCATGAGGAGCGG + Intronic
1037791526 8:21947247-21947269 TCACTGTTACTCAAGAGGGGAGG + Intronic
1038242575 8:25823466-25823488 CCAGAGTTAGCCAAGAAGAGAGG - Intergenic
1038361729 8:26886214-26886236 CCACAGTTACCCAAAAGCAGAGG + Intergenic
1040369993 8:46760061-46760083 CCAGTGTTACACAAGGGAAGAGG - Intergenic
1041151193 8:54936359-54936381 ACAGAGTTACAGCAGAGGAGGGG - Intergenic
1045458414 8:102405421-102405443 CCACAGTGAGCCAAGAGAAGAGG + Intronic
1046194027 8:110835370-110835392 ACACAGACACACATGAGGAGTGG + Intergenic
1049667365 8:143852180-143852202 CCACAGTTATGAAAGAGCAGTGG + Intergenic
1051592955 9:18794999-18795021 GCAAAGTTACAAAAGAGAAGTGG - Intronic
1053540227 9:38965992-38966014 CTCCAGTTAGACAAGAGGAAGGG + Intergenic
1057147604 9:92768654-92768676 CAAGAGCTACACAAGAGGAGAGG - Intergenic
1057714072 9:97475069-97475091 CATCAGTTACACATGAAGAGAGG - Intronic
1058175519 9:101732007-101732029 CCACATATACACAAGAATAGAGG - Intronic
1058214232 9:102213362-102213384 CCACAGTCACTCAAGAAAAGAGG + Intergenic
1059298439 9:113293560-113293582 TCCCAGTTACACAGGATGAGGGG - Intergenic
1060932869 9:127499801-127499823 TCCCAGATACGCAAGAGGAGAGG + Intronic
1062322437 9:135996977-135996999 CCACAATTACCCAAGATGGGCGG - Intergenic
1203692350 Un_GL000214v1:56154-56176 TTACAGTTAGATAAGAGGAGTGG + Intergenic
1203556534 Un_KI270744v1:3046-3068 TTACAGTTAGATAAGAGGAGTGG + Intergenic
1203643945 Un_KI270751v1:48037-48059 TTACAGTTAGATAAGAGGAGTGG - Intergenic
1187506218 X:19880597-19880619 CCACAGATGCACAAGCGGTGTGG + Intronic
1189064548 X:37793455-37793477 CCACAATTACACAACTAGAGAGG + Intronic
1191741407 X:64439153-64439175 ACACAGACACACATGAGGAGTGG - Intergenic
1195737685 X:108030672-108030694 CCACAGTCACAGAAGAGATGAGG - Intergenic
1197651696 X:129072286-129072308 TAACAATTAAACAAGAGGAGCGG - Intergenic
1197671735 X:129284827-129284849 CCACAGGGACCCAACAGGAGAGG - Intergenic
1197751916 X:129970532-129970554 CCACAGCTACTCAAGAGGCTAGG - Intergenic
1197957916 X:131972913-131972935 CAGCAGTTACAAAAGAGAAGTGG + Intergenic
1198266105 X:135010416-135010438 CCACAATTTGAGAAGAGGAGCGG - Intergenic
1198317251 X:135480493-135480515 ACACAGACACACAAGAGGAGTGG - Intergenic
1201361046 Y:13149106-13149128 AGACAGACACACAAGAGGAGTGG - Intergenic
1202086109 Y:21138513-21138535 CCACAGCTACATAAGATAAGGGG + Intergenic