ID: 983206500

View in Genome Browser
Species Human (GRCh38)
Location 4:164915898-164915920
Sequence ACCTTGGACATAAAAGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983206500_983206505 28 Left 983206500 4:164915898-164915920 CCTAGAGCTTTTATGTCCAAGGT No data
Right 983206505 4:164915949-164915971 CTGTGTTTGGCCCATAAAGAAGG No data
983206500_983206503 15 Left 983206500 4:164915898-164915920 CCTAGAGCTTTTATGTCCAAGGT No data
Right 983206503 4:164915936-164915958 ATCACCAGCATCACTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983206500 Original CRISPR ACCTTGGACATAAAAGCTCT AGG (reversed) Intergenic
No off target data available for this crispr