ID: 983206501

View in Genome Browser
Species Human (GRCh38)
Location 4:164915914-164915936
Sequence TCAGTGGACAAACTGCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983206501_983206508 29 Left 983206501 4:164915914-164915936 CCAAGGTGCAGTTTGTCCACTGA No data
Right 983206508 4:164915966-164915988 AGAAGGCTGCCTCCTATCATAGG No data
983206501_983206503 -1 Left 983206501 4:164915914-164915936 CCAAGGTGCAGTTTGTCCACTGA No data
Right 983206503 4:164915936-164915958 ATCACCAGCATCACTGTGTTTGG No data
983206501_983206505 12 Left 983206501 4:164915914-164915936 CCAAGGTGCAGTTTGTCCACTGA No data
Right 983206505 4:164915949-164915971 CTGTGTTTGGCCCATAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983206501 Original CRISPR TCAGTGGACAAACTGCACCT TGG (reversed) Intergenic
No off target data available for this crispr