ID: 983206573

View in Genome Browser
Species Human (GRCh38)
Location 4:164916747-164916769
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 2, 1: 1, 2: 3, 3: 60, 4: 657}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983206567_983206573 22 Left 983206567 4:164916702-164916724 CCAATATTAGTACAGGATGGATT 0: 1
1: 2
2: 0
3: 9
4: 113
Right 983206573 4:164916747-164916769 CAGAATAATTATATTGTATTGGG 0: 2
1: 1
2: 3
3: 60
4: 657

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902130096 1:14252785-14252807 CAGAATAAATTTATTGTGTTAGG - Intergenic
905845844 1:41230823-41230845 CAAAAAAATTATATTGAATTGGG - Intronic
906976928 1:50585781-50585803 CAAAATATTTATGTTATATTAGG - Intronic
907221418 1:52909693-52909715 CATAGTATTTACATTGTATTAGG - Intronic
907538811 1:55193160-55193182 CATAGCATTTATATTGTATTAGG + Intronic
907692703 1:56685851-56685873 CACAATCAATATATTGTAATTGG - Intronic
907790818 1:57661730-57661752 CATAGGATTTATATTGTATTAGG - Intronic
908333994 1:63101256-63101278 CAGAAAAAGTATAATGCATTGGG + Intergenic
908837352 1:68241177-68241199 TAGAATGATTATATTCTTTTGGG - Intergenic
909213861 1:72860543-72860565 CTTAATATTTATATTTTATTAGG + Intergenic
909268000 1:73586845-73586867 CATAATAATTAAATTTTAGTGGG + Intergenic
909851139 1:80465484-80465506 CTGCAAAATTATATTGCATTAGG + Intergenic
910153149 1:84179098-84179120 AAGAATATTTATATTGCATATGG - Intronic
910276588 1:85455925-85455947 CAGAAAAAGTATAATGTCTTTGG + Intronic
910367255 1:86479182-86479204 TTGAATATTTATTTTGTATTTGG - Intronic
911064557 1:93776518-93776540 CAAAATCTATATATTGTATTTGG + Intronic
911218208 1:95218622-95218644 CAGAGCATTTACATTGTATTAGG + Intronic
911354342 1:96797744-96797766 CATAACATTTATATTGTACTGGG - Intronic
912005743 1:104898340-104898362 AATAAGAATTATATTGTTTTAGG + Intergenic
912165856 1:107041201-107041223 TAGATGAATTATCTTGTATTAGG - Intergenic
912279283 1:108296459-108296481 TAGAATGATTATATTTTTTTGGG + Intergenic
912288943 1:108397898-108397920 TAGAATGATTATATTTTTTTGGG - Intronic
912320930 1:108712564-108712586 TAGAATAATTATTTTGAACTCGG - Intergenic
912784100 1:112582272-112582294 CAGAATCATTGTATTTTAATTGG - Intronic
913050254 1:115111280-115111302 CATAACATTTACATTGTATTAGG - Intergenic
913460024 1:119075266-119075288 CATAGCATTTATATTGTATTAGG + Intronic
914980775 1:152412624-152412646 CATAATAATTATATTTAATAAGG - Intronic
916100713 1:161390857-161390879 CAGTATAACTACATTGTATTAGG - Intergenic
916389280 1:164313334-164313356 CAGAATTATTTGATTGTATTTGG - Intergenic
917207086 1:172587456-172587478 GAGAAAAATTATATTGAATTTGG - Intronic
918268467 1:182870967-182870989 CAGATTAATGCTACTGTATTGGG + Intronic
918302587 1:183217529-183217551 CAGAATACATATATTCTTTTTGG - Intronic
918488843 1:185058176-185058198 CATAGCATTTATATTGTATTAGG + Intronic
918780567 1:188694540-188694562 CAGAATAATGAAGTTGAATTTGG + Intergenic
919034661 1:192291401-192291423 CAGAATTATTTTTTTGTTTTAGG - Intergenic
919238652 1:194881149-194881171 GAGAATAGTTATATTTTATAAGG + Intergenic
919319081 1:196011270-196011292 CATAGCATTTATATTGTATTAGG - Intergenic
919496455 1:198276247-198276269 CATCATAATTATAATGTAGTTGG - Intronic
919496798 1:198282748-198282770 CAGAATAAATAAATTGTACCTGG - Intronic
920001018 1:202798853-202798875 CAGAATTATTATTTTTTTTTAGG - Intronic
921350874 1:214233186-214233208 CAGAATTTATATATTATATTTGG + Intergenic
921733761 1:218603098-218603120 TAAATTAATTCTATTGTATTAGG - Intergenic
921847660 1:219901134-219901156 CAGAATATTTGCATTATATTAGG - Intronic
921891814 1:220361155-220361177 CAAAATAATGTGATTGTATTTGG + Intergenic
922283632 1:224149063-224149085 AAGAATATTTATAGTGTATTTGG - Intronic
922922855 1:229321945-229321967 CAGAGCATTTACATTGTATTAGG + Exonic
922995860 1:229960413-229960435 CATAATGTTTATATTGTATTAGG - Intergenic
923925927 1:238627206-238627228 CAGGATAGTTATATTATGTTGGG - Intergenic
924130518 1:240902373-240902395 TAAAATAAATATATTTTATTTGG + Intronic
924193797 1:241583648-241583670 CATGACATTTATATTGTATTAGG - Intronic
924657879 1:245989931-245989953 CAGAATAGATCTTTTGTATTTGG - Intronic
1063290610 10:4743168-4743190 TAAAATAAGTATATTGTATCTGG - Intergenic
1063563651 10:7152126-7152148 CAGAATGATCAAACTGTATTGGG - Intergenic
1063928184 10:11001474-11001496 AAGAATCATTAAGTTGTATTTGG + Intergenic
1064088494 10:12363555-12363577 CATAACATTTACATTGTATTGGG - Intronic
1065371659 10:24992965-24992987 CAGAAAGATTAAATTATATTTGG + Intronic
1065648240 10:27859635-27859657 CAGTAAAATTATATTGTACAAGG + Intronic
1065922819 10:30408103-30408125 TAGTAAAATTGTATTGTATTAGG + Intergenic
1066348080 10:34608873-34608895 CATAGCATTTATATTGTATTAGG + Intronic
1066545607 10:36497166-36497188 CAGAATTATTTTATTAAATTGGG + Intergenic
1067075562 10:43178638-43178660 CATAGTATTTACATTGTATTAGG - Intronic
1067264725 10:44730038-44730060 AAAAATATTTATATTGTTTTTGG + Intergenic
1067988668 10:51182960-51182982 CACAATAATTCTATTGATTTTGG + Intronic
1068314946 10:55328735-55328757 CATAATATTTACATTTTATTCGG + Intronic
1068672651 10:59739454-59739476 CATAGCACTTATATTGTATTAGG - Intergenic
1070055746 10:72932977-72932999 CAGACTAATTATAGGGAATTTGG + Exonic
1070319075 10:75340956-75340978 CAGAATGAATATATTGTCCTGGG - Intergenic
1072103145 10:92248228-92248250 CATAACACTTACATTGTATTAGG - Intronic
1072918581 10:99556474-99556496 CATAATAAATATATTGGATGGGG + Intergenic
1072927862 10:99632234-99632256 CATAACATTTACATTGTATTAGG + Intergenic
1073792349 10:106953359-106953381 CATAATATTTATATTTTATTTGG - Intronic
1074388226 10:113034496-113034518 CAGAGTATTGATTTTGTATTTGG + Intronic
1078241147 11:9531615-9531637 CAGAATATTTATCTCATATTTGG - Intergenic
1078284457 11:9937502-9937524 TAGGATAATTATTTTTTATTTGG - Intronic
1078669284 11:13350771-13350793 AAGAATATTTATATTATTTTGGG + Intronic
1078851710 11:15170093-15170115 CATAGTATTTACATTGTATTAGG - Intronic
1079605419 11:22359604-22359626 GTAAATAAATATATTGTATTAGG + Intronic
1079651845 11:22939654-22939676 CAGCATAATTAAATTTTCTTTGG - Intergenic
1080106374 11:28515360-28515382 TAGGAAAATTCTATTGTATTAGG - Intergenic
1080544570 11:33303258-33303280 CAAAGTATTTACATTGTATTAGG - Intronic
1081240790 11:40704124-40704146 CAGAGCATTTACATTGTATTAGG + Intronic
1081263510 11:40989926-40989948 CATAGTATTTATATTGTGTTAGG + Intronic
1081301873 11:41462554-41462576 CATAGTATTTACATTGTATTAGG + Intergenic
1081302824 11:41473894-41473916 CATAACATTTACATTGTATTAGG - Intergenic
1081355286 11:42105215-42105237 CATAATAAATATGATGTATTAGG - Intergenic
1081800763 11:45857676-45857698 CAGAAGAATTATATTGAAGGAGG + Intronic
1082100062 11:48165514-48165536 CAGAATATTAATTTTGTATCAGG + Intronic
1082187158 11:49197688-49197710 CATAACAATTAAATTGTACTGGG + Intronic
1082247445 11:49941304-49941326 CAAATTTATTATTTTGTATTTGG - Intergenic
1082293881 11:50414702-50414724 CAGATTAATGCTACTGTATTGGG + Intergenic
1085985547 11:81783128-81783150 CATAGTATTTACATTGTATTAGG + Intergenic
1086258385 11:84907768-84907790 CTCAATATTTATATTGTCTTGGG - Intronic
1086529816 11:87771666-87771688 CAGAATAATTATAAGACATTAGG + Intergenic
1086679181 11:89647736-89647758 CATAACAATTAAATTGTACTGGG - Intergenic
1086857427 11:91881858-91881880 CAGAAAAATTACATTGTACCTGG + Intergenic
1087404483 11:97712970-97712992 GAGGATAATTATATTATTTTTGG + Intergenic
1087408892 11:97765740-97765762 CATAACATTTACATTGTATTGGG - Intergenic
1087657568 11:100943119-100943141 CAAAACAATCACATTGTATTAGG + Intronic
1088033102 11:105276295-105276317 CAGAATCATTACATTTTAGTGGG - Intergenic
1088062942 11:105679489-105679511 CAGAATAATTGTATTATGTTAGG - Intronic
1088097497 11:106117414-106117436 AAGAATAACTGTATTATATTAGG + Intergenic
1088381308 11:109195843-109195865 AAGAATAATTTTCTTTTATTAGG + Intergenic
1088997856 11:115018757-115018779 CATAGCATTTATATTGTATTAGG + Intergenic
1089769995 11:120795935-120795957 CATAACACTTATACTGTATTAGG - Intronic
1090826329 11:130389243-130389265 AAGAATAATCATGTGGTATTAGG - Intergenic
1091100779 11:132871464-132871486 CATAATGTTTACATTGTATTAGG + Intronic
1091535274 12:1401473-1401495 TAAAATAATTATATTTTATATGG - Intronic
1091536007 12:1410048-1410070 CACAGTATTTACATTGTATTAGG - Intronic
1092686852 12:11058237-11058259 AATAATAATTATATATTATTTGG + Intronic
1093513585 12:19958067-19958089 CTGAAGAATTCTATTGTAGTTGG - Intergenic
1093719211 12:22418920-22418942 CATTTTAAATATATTGTATTAGG - Intronic
1093719710 12:22425560-22425582 CATTTTAAATATATTGTATTAGG - Intronic
1093859879 12:24151910-24151932 TAGAATAAATATATTTTATATGG - Intergenic
1094042324 12:26131147-26131169 CAGCATCATTTTATTGTATTAGG + Intronic
1094049358 12:26202105-26202127 CATAGTATTTATATTGTATTAGG - Intronic
1094133648 12:27101250-27101272 CATAGCATTTATATTGTATTAGG - Intergenic
1094265577 12:28555498-28555520 AAGAAAAATTATACTGTAATTGG + Intronic
1094717403 12:33026699-33026721 CACAATAAATATAATGAATTGGG - Intergenic
1095757693 12:45787760-45787782 CAGAATAATTATATTAATATAGG + Intronic
1096711872 12:53463508-53463530 CATAGTATTTACATTGTATTAGG + Intronic
1096942568 12:55363890-55363912 CAGAATTTTTAAAATGTATTTGG + Intergenic
1097429322 12:59484880-59484902 CATATTATTTACATTGTATTAGG + Intergenic
1097511819 12:60552143-60552165 TAAAATAATTATATTCTTTTGGG - Intergenic
1097744511 12:63286499-63286521 GAGAATAATTATATCTTAATGGG - Intergenic
1097748053 12:63320958-63320980 CATATTATTTACATTGTATTAGG - Intergenic
1097831272 12:64226555-64226577 CACAAAAATTATATTGAAATGGG - Intergenic
1098475281 12:70894281-70894303 CATGATAATTCTATTGAATTTGG - Intronic
1098593822 12:72247182-72247204 CATAATATTTACATTGTATTAGG - Intronic
1099116916 12:78638802-78638824 TAGAATAATTAAAGTGTAATAGG + Intergenic
1099193112 12:79581377-79581399 CAGAGCATTTACATTGTATTAGG - Intronic
1099366937 12:81777689-81777711 CTGAATATTAAAATTGTATTAGG + Intergenic
1099371182 12:81833258-81833280 CATAGTATTTACATTGTATTAGG + Intergenic
1099500847 12:83412818-83412840 CAGAAGAAAAATATTATATTTGG + Intergenic
1099716845 12:86305739-86305761 CATATAATTTATATTGTATTAGG - Intronic
1100164011 12:91895623-91895645 GAGAATAATTTTACTGTATTTGG - Intergenic
1100344432 12:93713563-93713585 CAAAGCATTTATATTGTATTAGG - Intronic
1100713245 12:97279463-97279485 CAGAAAAAGTATATTGACTTTGG + Intergenic
1100782541 12:98044599-98044621 CATACTATTTACATTGTATTAGG - Intergenic
1101162710 12:101995166-101995188 AATAATAATTAGATTGTATTAGG - Intronic
1101179875 12:102204376-102204398 CAGAAAAATTAGATTGTAGATGG + Intergenic
1101341250 12:103842929-103842951 CAGAGCATTTATATTGTATTAGG - Intronic
1101455082 12:104823860-104823882 TAATAAAATTATATTGTATTAGG + Intronic
1103034542 12:117646080-117646102 CATAACATTTACATTGTATTAGG - Intronic
1103273897 12:119695872-119695894 CAGAGCATTTACATTGTATTAGG - Intronic
1105455417 13:20536344-20536366 CAATAAAATTATATTCTATTAGG - Intergenic
1105477681 13:20742644-20742666 CAGAATAATTATTATGTAGGAGG - Intronic
1105739263 13:23305102-23305124 CAGAAAACTTATTTTGTATTAGG + Intronic
1105934188 13:25083608-25083630 CATAGTATTTACATTGTATTAGG - Intergenic
1106059840 13:26278904-26278926 CATAGTATTTACATTGTATTAGG + Intronic
1106498496 13:30305295-30305317 AAGAATCAGTATTTTGTATTTGG - Intronic
1106620859 13:31369173-31369195 CAGAAAAATCATTTTGCATTTGG - Intergenic
1106734296 13:32573304-32573326 CACAACACTTACATTGTATTAGG - Intergenic
1107258353 13:38458762-38458784 CACAATACTTTTATTGTGTTGGG + Intergenic
1107828069 13:44348492-44348514 CATAGCATTTATATTGTATTAGG + Intergenic
1108571073 13:51752026-51752048 CAGAATAATTCTAACGTAATTGG - Intronic
1108789198 13:53946302-53946324 CAGAAAAATACTACTGTATTAGG - Intergenic
1108951164 13:56095912-56095934 CAGAATATTTAAACTGTGTTTGG + Intergenic
1109560593 13:64044374-64044396 CAAAATACTTATATTTTATTTGG - Intergenic
1109680321 13:65743595-65743617 AATAATAATAATAATGTATTAGG - Intergenic
1110338045 13:74354989-74355011 AAAAATAATTATGTTGTTTTTGG + Intergenic
1110354591 13:74552637-74552659 CATAGTATTTACATTGTATTAGG + Intergenic
1110449955 13:75630114-75630136 CATAGTATTTACATTGTATTAGG - Intronic
1110723464 13:78791999-78792021 TAGAATTATTATCTTGTTTTAGG + Intergenic
1111353481 13:87064458-87064480 CACAGTATTTACATTGTATTAGG - Intergenic
1111431999 13:88157505-88157527 CAGGATAGTTATATTGTGTTAGG - Intergenic
1111465867 13:88609333-88609355 CATAATAATTATATTTAAATTGG - Intergenic
1111495796 13:89048109-89048131 GACAAAAATTATATTGTTTTGGG + Intergenic
1111635767 13:90901968-90901990 CAGTATTATTTTATTGGATTTGG - Intergenic
1112182475 13:97097788-97097810 CAAAAGAATTTTATTGTGTTAGG + Intergenic
1112517588 13:100068190-100068212 CATAGCATTTATATTGTATTAGG + Intergenic
1113168358 13:107469596-107469618 CATAATATTTATATTGTACTTGG - Intronic
1113346584 13:109483688-109483710 CGGAAAAATTAGTTTGTATTTGG - Intergenic
1114302186 14:21388391-21388413 CATAGTATTTATATTGTGTTAGG + Intronic
1114926320 14:27403958-27403980 CATAGCATTTATATTGTATTTGG + Intergenic
1114985302 14:28219242-28219264 CTGACTAGTTATTTTGTATTAGG - Intergenic
1115274556 14:31593113-31593135 CATAAAATTTATATTATATTTGG + Intronic
1116345550 14:43788211-43788233 CAGAATATTTTTATTGTTCTAGG - Intergenic
1116571539 14:46523442-46523464 CTGATGAATGATATTGTATTAGG + Intergenic
1116612551 14:47094823-47094845 TAGAAAAATTGTATTGTAATCGG - Intronic
1116799104 14:49424435-49424457 CAGAATACTTGAATTGGATTGGG - Intergenic
1116833376 14:49744657-49744679 CATAGTATTTAAATTGTATTAGG - Intronic
1116874625 14:50098651-50098673 CATAACATTTACATTGTATTAGG - Intergenic
1116968169 14:51036571-51036593 CATAGTACTTACATTGTATTAGG - Intronic
1117056797 14:51920345-51920367 TATAATTATTATATTGTATTAGG - Intronic
1117605028 14:57419934-57419956 CAGGGTAATTTAATTGTATTTGG - Intergenic
1117683782 14:58232289-58232311 TATAATGATTATATAGTATTTGG + Intronic
1118208518 14:63745719-63745741 CATAATAATTCTGTTGGATTTGG - Intergenic
1118535864 14:66763655-66763677 TATAATATTCATATTGTATTAGG + Intronic
1118654792 14:67935131-67935153 CTGACTAATTATAGTGTACTTGG + Intronic
1119115009 14:72011634-72011656 CATAGCATTTATATTGTATTAGG + Intronic
1120425665 14:84344504-84344526 CATAATATTTACATTATATTTGG - Intergenic
1120441000 14:84539419-84539441 CAGTATAATTATTTTTTACTGGG + Intergenic
1121264648 14:92592584-92592606 CATAGTACTTACATTGTATTGGG - Intronic
1121478265 14:94235142-94235164 CATAGCATTTATATTGTATTAGG - Intronic
1121856969 14:97279232-97279254 CAGATTACTTATTTTATATTTGG - Intergenic
1122589765 14:102839649-102839671 CTGAGTAATTATATAGTATCTGG - Intronic
1124031278 15:26014513-26014535 CATAGCATTTATATTGTATTAGG + Intergenic
1124378952 15:29148530-29148552 CATAGCATTTATATTGTATTAGG - Intronic
1125344631 15:38706554-38706576 CATAGTATTTACATTGTATTAGG - Intergenic
1125364636 15:38900974-38900996 CATAGCATTTATATTGTATTAGG + Intergenic
1126842330 15:52729371-52729393 CATAATAATTTTATTATATTAGG + Intergenic
1126937180 15:53723766-53723788 CATAGCATTTATATTGTATTAGG - Intronic
1127083253 15:55401037-55401059 GAGAATAATTTTATAGTCTTGGG - Intronic
1127524054 15:59774693-59774715 CTCAATACTTATATTCTATTTGG - Intergenic
1128343490 15:66839036-66839058 CATAACATTTACATTGTATTAGG + Intergenic
1128661401 15:69503699-69503721 TAGAGTAATAATATTGTAGTTGG - Intergenic
1129002339 15:72345202-72345224 CATAGCATTTATATTGTATTAGG - Intronic
1130720834 15:86384494-86384516 CAGTATAATAATAAAGTATTTGG - Intronic
1130873355 15:87990469-87990491 CAGATTATTTATCTTGTTTTGGG + Intronic
1131350356 15:91694040-91694062 GGGAATAATTAAATTGTATCTGG + Intergenic
1131886847 15:96925043-96925065 CACAGTATTTACATTGTATTAGG - Intergenic
1133362128 16:5182629-5182651 CGTAATACTTACATTGTATTGGG + Intergenic
1133666771 16:7975818-7975840 CAGAATAATTTTATTTCCTTTGG - Intergenic
1135588689 16:23690297-23690319 CAGAATATTTCTATTGAATTCGG + Exonic
1135898985 16:26438699-26438721 GACACTAATTATATTGGATTAGG + Intergenic
1137707663 16:50547054-50547076 CATAACATTTACATTGTATTAGG - Intergenic
1138051915 16:53787542-53787564 AAAAAAAATTATTTTGTATTAGG + Intronic
1138138791 16:54548427-54548449 CAGAATAATATTATTGTACACGG + Intergenic
1138707952 16:58937100-58937122 CATAGCATTTATATTGTATTAGG + Intergenic
1139763992 16:69211338-69211360 AAGAATTATTAAATGGTATTAGG - Intronic
1141194226 16:81847752-81847774 CATAACATTTACATTGTATTAGG + Intronic
1141207478 16:81944375-81944397 CACAGTATTTATATTGTCTTGGG + Intronic
1142952979 17:3498853-3498875 CAAAATAAATATATTATATTTGG - Intronic
1143225057 17:5294445-5294467 CATAGTATTTACATTGTATTAGG + Intronic
1143611965 17:8023291-8023313 CATAGCATTTATATTGTATTAGG + Intergenic
1144247954 17:13386154-13386176 CATAATCATTATATTATTTTGGG + Intergenic
1145853976 17:28134451-28134473 CATAGTATTTATATTTTATTAGG + Intronic
1146115886 17:30138500-30138522 CATAGTATTTACATTGTATTAGG - Intronic
1146290635 17:31604470-31604492 CAGAGAAATTATACTGTCTTTGG - Intergenic
1147777754 17:42914939-42914961 CAAAATGATTATTTTGTATCTGG - Intergenic
1149040005 17:52176711-52176733 CATAAAACTTATATTGTAGTTGG + Intergenic
1149042006 17:52201336-52201358 TATAACAACTATATTGTATTAGG - Intergenic
1149500457 17:57148395-57148417 AAAAATAATTATATTCTATAGGG - Intergenic
1149721896 17:58853219-58853241 AATAATAATTTTATAGTATTAGG + Intronic
1150541172 17:66100853-66100875 CATATCATTTATATTGTATTAGG + Intronic
1151010257 17:70484833-70484855 CAGAATTATTATATTATTTTGGG - Intergenic
1153293577 18:3524408-3524430 AAGTAAAATTATCTTGTATTAGG + Intronic
1153375406 18:4371702-4371724 GAGAGTAAATATTTTGTATTTGG + Intronic
1153820401 18:8826832-8826854 AATGATAATCATATTGTATTAGG - Intronic
1153936719 18:9933149-9933171 CAGAATTATTATAATATCTTAGG - Intronic
1154326721 18:13396429-13396451 CACAACATTTATATTGTATGTGG - Intronic
1154459444 18:14566094-14566116 CATAGCATTTATATTGTATTAGG + Intergenic
1155510501 18:26571553-26571575 CATAGCATTTATATTGTATTAGG - Intronic
1155556886 18:27029672-27029694 CATAGCATTTATATTGTATTAGG - Intronic
1155631278 18:27896351-27896373 CATAGCATTTATATTGTATTAGG - Intergenic
1155988585 18:32256265-32256287 CATAACATTTACATTGTATTAGG + Intronic
1156147804 18:34207325-34207347 CAGAAAAAAAATATTATATTTGG + Intronic
1157357678 18:46950444-46950466 CAGAATATTTTCTTTGTATTTGG + Intronic
1157891667 18:51424008-51424030 CTGAATATTTATGTTGTATTTGG - Intergenic
1157913821 18:51644957-51644979 CAGAGCATTTACATTGTATTAGG + Intergenic
1158102365 18:53843447-53843469 CAGAATGATAAAATTGTAATTGG - Intergenic
1159211918 18:65334346-65334368 TAGGAAAATTATATTGTGTTAGG - Intergenic
1159238667 18:65711257-65711279 CAAAATATTTATATTTTACTAGG + Intergenic
1159355020 18:67327884-67327906 CAGAGCATTTACATTGTATTAGG - Intergenic
1159487500 18:69083343-69083365 CAGAATGGTTATATCATATTAGG + Intergenic
1159596396 18:70386401-70386423 CATAGCAATTATATTGTATTAGG - Intergenic
1159688414 18:71453889-71453911 TACATTATTTATATTGTATTAGG + Intergenic
1159808304 18:72982686-72982708 GAGAATGATTAAATTGTATGCGG + Intergenic
1163091526 19:15023259-15023281 AACAATAATTATCATGTATTAGG + Exonic
1164621932 19:29701407-29701429 CATAGCATTTATATTGTATTTGG - Intronic
1167978989 19:53256625-53256647 CAGAATTATTATATTTTCATAGG + Intergenic
1168163132 19:54526144-54526166 CAGAATAATTATTTTATCATAGG - Intergenic
1168482053 19:56728515-56728537 CAGAACATTAATATTTTATTTGG + Intergenic
926265116 2:11309202-11309224 CATAGTATTTACATTGTATTAGG + Intronic
926506013 2:13716968-13716990 CAGAGCATTTACATTGTATTGGG - Intergenic
926655718 2:15403513-15403535 CATAACATTTACATTGTATTAGG + Intronic
927121387 2:19966951-19966973 GAGAAGAATTATTTAGTATTGGG + Intronic
928604471 2:32932761-32932783 CATAGCATTTATATTGTATTAGG - Intergenic
928976770 2:37095477-37095499 AAGAACATCTATATTGTATTTGG + Exonic
929626146 2:43409604-43409626 AAGTATAATTATACTGTATAAGG - Intronic
929745209 2:44650097-44650119 AAGAATAATTTTGTTGTTTTAGG - Intronic
930004590 2:46886184-46886206 CATAGTATTTACATTGTATTGGG + Intergenic
930399849 2:50870039-50870061 CTCAATAATAATATTGTAATTGG + Intronic
930421243 2:51155506-51155528 CAGCATAATTATTTTGTCCTAGG - Intergenic
930480815 2:51946355-51946377 TTGAATAATGATAGTGTATTAGG + Intergenic
930774665 2:55160212-55160234 TAGAAGAAATATACTGTATTTGG - Intergenic
931039623 2:58282967-58282989 CAGAACATTCACATTGTATTAGG - Intergenic
931043234 2:58321171-58321193 TAAAATAAATATATTGTATATGG - Intergenic
931354789 2:61527160-61527182 AAGAATTTTTATATTGTTTTTGG - Intronic
931523808 2:63129865-63129887 CATAATAATTACATTGTATTAGG - Intronic
931599164 2:63985718-63985740 CAGTATAGTTAAATTGTAGTTGG + Intronic
931933318 2:67166218-67166240 AAGAATAATTATCTTGGGTTTGG + Intergenic
932039030 2:68278904-68278926 CAGAAAAATAAAATTGAATTTGG + Intergenic
932202744 2:69846377-69846399 CATAACATTTACATTGTATTAGG + Intronic
932681737 2:73831740-73831762 AAAAATAATTATAATGTATTTGG + Intronic
932923812 2:75947006-75947028 CAGAATATATATGGTGTATTAGG + Intergenic
933035400 2:77391126-77391148 AAGAATAATTATTTTTTACTTGG - Intronic
933177927 2:79196606-79196628 CAGAATAATTATTAAGTATAAGG - Intronic
934197065 2:89846499-89846521 CAAAATAATGATTTTGTTTTGGG - Intergenic
934586325 2:95500653-95500675 CAGAATTGGTATATTGAATTCGG + Intergenic
935049836 2:99515589-99515611 CAGTATAACAACATTGTATTAGG + Intergenic
935473826 2:103493498-103493520 CAGACTCATTAAATTGTATTTGG + Intergenic
935599726 2:104910931-104910953 CATAGTATTTACATTGTATTAGG + Intergenic
935741907 2:106156691-106156713 CATAACATTTACATTGTATTAGG - Intronic
936391966 2:112083161-112083183 CAGACTAATTTTTTTGTTTTGGG + Intronic
937174896 2:119920598-119920620 AACAATAATTATATAGTTTTAGG - Intronic
937193451 2:120127485-120127507 CATAGCATTTATATTGTATTAGG - Intronic
937664744 2:124472534-124472556 CATATTAATTATATTGAATAAGG + Intronic
937845996 2:126579594-126579616 CATAGCATTTATATTGTATTAGG + Intergenic
938857782 2:135332810-135332832 CAGAAAAAATATAATGGATTTGG - Intronic
938902245 2:135808186-135808208 CAGAATATTCATATTGTCATGGG - Intronic
939267702 2:139894938-139894960 CATAACATTTACATTGTATTAGG + Intergenic
939292433 2:140213688-140213710 CATAGCATTTATATTGTATTAGG + Intergenic
939313502 2:140516334-140516356 CATAATATTTACATTGTATTAGG + Intronic
939760999 2:146179616-146179638 CAGGATAATGCTATTGTCTTAGG - Intergenic
940028111 2:149230057-149230079 CAGATTCATTATATCGTTTTTGG + Intergenic
940641996 2:156354725-156354747 CACAGCATTTATATTGTATTAGG + Intergenic
940840823 2:158579893-158579915 CATAATAATTAAATAGTACTTGG + Intronic
941244154 2:163075933-163075955 CAGAAAAATTATGTTGAAATAGG - Intergenic
941246610 2:163106029-163106051 CATAACAATTACATTTTATTGGG + Intergenic
941409667 2:165138718-165138740 CATAATAATTATTTTGTAACAGG - Intronic
941447677 2:165623136-165623158 CATGGTATTTATATTGTATTAGG + Intronic
941462348 2:165786553-165786575 CACAATATTTACATTGAATTAGG - Intronic
941625558 2:167826810-167826832 CATAACATTTACATTGTATTAGG + Intergenic
943034818 2:182729529-182729551 TACAATATGTATATTGTATTTGG + Intronic
943327976 2:186524547-186524569 CTAAATATTTAGATTGTATTTGG - Intergenic
943524370 2:188997811-188997833 CAGATAAATTATAATCTATTAGG - Intronic
944191611 2:197009943-197009965 CAGTATGATTATATGGAATTGGG - Intronic
944391053 2:199220092-199220114 CAGAAAAATTATTTTGGATTTGG + Intergenic
944488216 2:200229316-200229338 CAGAAAAATGCTATTGAATTTGG - Intergenic
944752709 2:202727572-202727594 CATAGTATTTACATTGTATTAGG + Intronic
944965727 2:204930388-204930410 CATAGTATTTACATTGTATTAGG - Intronic
945345755 2:208713479-208713501 CAGAATAATTGAATTGAGTTTGG - Intronic
945478703 2:210318943-210318965 TAAAATAATTATTTTCTATTTGG + Intergenic
945656715 2:212633003-212633025 CATAATAATTATAATGGCTTTGG - Intergenic
945830542 2:214779342-214779364 CATAGCATTTATATTGTATTAGG - Intronic
945844244 2:214924999-214925021 CAGATGATTTATCTTGTATTTGG - Intergenic
945968589 2:216214483-216214505 AAGAATAATTTTATTTAATTTGG - Intergenic
946171192 2:217896878-217896900 CAGAGCGTTTATATTGTATTAGG - Intronic
946477665 2:220024288-220024310 CAGAATAAAAATCTTGTATTTGG + Intergenic
946724221 2:222646124-222646146 CGGAATAATTATATTGTATTGGG - Intronic
947310113 2:228792432-228792454 CAAAATATTTACATTGTATTAGG + Intergenic
947677806 2:232000147-232000169 CATACCATTTATATTGTATTAGG - Intronic
947882995 2:233536854-233536876 CATAGCATTTATATTGTATTAGG + Intronic
948085959 2:235248427-235248449 CATACTATTTACATTGTATTAGG + Intergenic
1169022164 20:2338432-2338454 CAGCATAATTTTATGCTATTGGG - Intronic
1170669286 20:18415888-18415910 GAGAACAATTATTTTATATTGGG + Intronic
1171236524 20:23530342-23530364 CAAGATTACTATATTGTATTTGG - Intergenic
1172265377 20:33607713-33607735 GATAATAATCATATTGGATTAGG + Intronic
1172730437 20:37082672-37082694 CATAGTATTTACATTGTATTAGG + Intronic
1174033053 20:47646189-47646211 CATAACATTTACATTGTATTAGG - Intronic
1174901010 20:54500447-54500469 CAAAATGATAATTTTGTATTGGG - Intronic
1175088534 20:56482334-56482356 CACAGCATTTATATTGTATTAGG - Intronic
1175474511 20:59261611-59261633 TAGACTAATAATATTGTGTTGGG - Intergenic
1175557042 20:59871761-59871783 AAGAGTATTTACATTGTATTAGG - Intronic
1176234409 20:64047754-64047776 AAAATTAAATATATTGTATTAGG + Exonic
1176814700 21:13587244-13587266 CATAGCATTTATATTGTATTAGG - Intergenic
1176910000 21:14553173-14553195 CAAAATAATTATAAGGTAGTTGG - Intronic
1178685147 21:34704860-34704882 CAGAATAATTATATTGCACGGGG - Intronic
1178776371 21:35554903-35554925 CAAACTACTTATTTTGTATTTGG + Intronic
1179638190 21:42728128-42728150 CATAACATTTACATTGTATTAGG + Intronic
1180464264 22:15596950-15596972 CATAATAGTTATAAAGTATTAGG + Intergenic
1182214289 22:28702884-28702906 CATAACATTTACATTGTATTAGG - Intronic
1182253406 22:29020142-29020164 CATAGTACTTACATTGTATTAGG - Intronic
949698680 3:6730127-6730149 CATAGCATTTATATTGTATTAGG + Intergenic
952500617 3:33958356-33958378 CATAACATTTACATTGTATTAGG + Intergenic
952606446 3:35153021-35153043 CAGTTTAATTATATTCTATTTGG + Intergenic
952836067 3:37603331-37603353 CATATTATTTACATTGTATTGGG + Intronic
953089561 3:39710893-39710915 CATAGCATTTATATTGTATTGGG + Intergenic
955284733 3:57629081-57629103 CAGAATAATTGTCTCATATTTGG + Intronic
956060730 3:65345512-65345534 CATAGCACTTATATTGTATTAGG + Intergenic
956113677 3:65897081-65897103 CATAACATTTGTATTGTATTAGG - Intronic
956753485 3:72363582-72363604 CAATATTATTATACTGTATTTGG - Intergenic
956912723 3:73835913-73835935 CAGAAAACTTCTCTTGTATTGGG + Intergenic
957234297 3:77565030-77565052 ATGAATAAGTAGATTGTATTGGG - Exonic
957604967 3:82386522-82386544 AAGAAAAATTATTTTGTAATTGG + Intergenic
957721611 3:84009188-84009210 CATATTAATTTTATTTTATTTGG + Intergenic
957753948 3:84462638-84462660 CAGAGTATTTACATTGTACTAGG + Intergenic
958040124 3:88217548-88217570 CTTAACAATTAAATTGTATTTGG - Intergenic
958698897 3:97562948-97562970 CAAAATACATATTTTGTATTTGG - Intronic
958778846 3:98517599-98517621 CATAGCATTTATATTGTATTGGG + Intronic
958853227 3:99354004-99354026 CAAAATAATTTGATTTTATTTGG + Intergenic
958899991 3:99874563-99874585 AAGAAAAATTATATGTTATTTGG - Intronic
958924432 3:100142385-100142407 CATAGTATTTATATTGTATCAGG + Intronic
959036417 3:101370542-101370564 CATAACATTTATGTTGTATTGGG - Intronic
959176234 3:102914883-102914905 CAGAATTAGTATAGTGTCTTAGG + Intergenic
959770073 3:110083725-110083747 CAGAAAATTTTTATTTTATTTGG + Intergenic
959806929 3:110566125-110566147 AAGAATAATTATCTGGTAATTGG - Intergenic
959810828 3:110617113-110617135 CAGAATATTTATATCTTATAGGG - Intergenic
960417434 3:117401602-117401624 CAGAATAAATTTTTTGTCTTTGG - Intergenic
960502036 3:118449477-118449499 AAGAATAGTTATATTTCATTGGG + Intergenic
960643300 3:119849976-119849998 CATAGTATTTACATTGTATTCGG - Intronic
962005588 3:131346138-131346160 TAATAAAATTATATTGTATTGGG + Intronic
962229983 3:133655890-133655912 CAGAATAATGATATTTTTGTTGG - Intronic
963378957 3:144505034-144505056 AAGAATAATTGTATTATGTTAGG - Intergenic
963397528 3:144752738-144752760 CAGAATAATTTTCATGTCTTGGG + Intergenic
963609332 3:147445215-147445237 CAAAATAATTTTATTGTGTTAGG + Intronic
963655346 3:148041866-148041888 CATAGTATTTACATTGTATTAGG + Intergenic
963859969 3:150299054-150299076 CAATATAATTATATCATATTTGG - Intergenic
965048219 3:163607469-163607491 TAGAAAAATTTTATTGTGTTCGG - Intergenic
965062170 3:163797866-163797888 CAAAACAATAATAATGTATTAGG - Intergenic
965091843 3:164174113-164174135 AAAATTAATTATAATGTATTTGG + Intergenic
965153868 3:165019680-165019702 CAGAATATATATATGGTTTTGGG - Exonic
965204750 3:165707265-165707287 CAGAGCATTTACATTGTATTAGG - Intergenic
965305097 3:167054280-167054302 GAGAATAATGATACTTTATTGGG - Intergenic
965385533 3:168041611-168041633 AACAAAAATGATATTGTATTGGG + Intronic
965402335 3:168226872-168226894 CAGAATAATTTTATTAGTTTTGG + Intergenic
965958815 3:174404678-174404700 CAAAATAATTCTATTTTATATGG + Intergenic
966658720 3:182389871-182389893 CAAAATAATTAGAATGTTTTTGG - Intergenic
966742538 3:183247732-183247754 CATAGTATTTATATTGTATTAGG + Intronic
966760711 3:183416782-183416804 CACAGCATTTATATTGTATTAGG + Intronic
966815449 3:183886278-183886300 CACAAAGATTCTATTGTATTGGG + Intergenic
967581634 3:191163858-191163880 CAAAATAATTACACTGTCTTAGG + Intergenic
968143809 3:196280478-196280500 CATAGTATTTACATTGTATTAGG - Intronic
968738621 4:2314710-2314732 CAAAATAATTATAGTGTCTGTGG - Intronic
969093528 4:4715250-4715272 TGTAATAATTGTATTGTATTGGG - Intergenic
969204929 4:5636512-5636534 CATAACATTTACATTGTATTAGG + Intronic
970428944 4:15970734-15970756 CATAACACTTACATTGTATTAGG - Intronic
971195136 4:24466063-24466085 CAGAATAATTATGGTTTAGTGGG - Intergenic
971207799 4:24586808-24586830 CATAGCAATTACATTGTATTAGG + Intergenic
971724501 4:30292843-30292865 CACAATAAGTCTATTGTTTTAGG - Intergenic
971776993 4:30978719-30978741 CAAAAGAAGTATATTGTATTAGG - Intronic
971952024 4:33363765-33363787 CATAACATTTACATTGTATTAGG + Intergenic
972071483 4:35023520-35023542 TAGAATTATTATTTTTTATTAGG - Intergenic
972120129 4:35691698-35691720 TGGGATAAGTATATTGTATTTGG - Intergenic
972414048 4:38821266-38821288 CATAACATTTACATTGTATTAGG + Intronic
972453374 4:39227544-39227566 CATAGCATTTATATTGTATTAGG + Intronic
972567161 4:40279937-40279959 CATAACATTTACATTGTATTTGG - Intergenic
972840684 4:42927020-42927042 CAGAATAATAATAATGATTTGGG - Intronic
972972198 4:44591396-44591418 TATAATAATTTTATTCTATTTGG - Intergenic
972982436 4:44722629-44722651 CACAGTATTTACATTGTATTAGG + Intronic
973192786 4:47405551-47405573 GAGATTAATTATTTTGTTTTAGG - Intronic
973983710 4:56328749-56328771 CTGAAAAATTAGATTGCATTAGG - Intergenic
974319366 4:60326142-60326164 CTGATTAATTATATTTTATTTGG - Intergenic
974356891 4:60824350-60824372 CAGAATAGTTTTGTGGTATTTGG - Intergenic
974462867 4:62210562-62210584 CAGAATAATTATTTTAAATTAGG - Intergenic
975866770 4:78731884-78731906 CATATTATTTACATTGTATTAGG - Intergenic
976173320 4:82326733-82326755 CATAATATTTACATTGTATTAGG + Intergenic
976572634 4:86630967-86630989 CAGAATCATTATTATGTTTTTGG - Intronic
976717925 4:88143059-88143081 CATAACATTTACATTGTATTAGG + Intronic
977148512 4:93478351-93478373 CAGAAATATTTTATGGTATTGGG + Intronic
977648353 4:99439992-99440014 CACATTTATAATATTGTATTAGG - Intergenic
977850923 4:101828071-101828093 CAGGATAATTATAGACTATTTGG - Intronic
978158776 4:105520460-105520482 CAGAATATTTACATTGTACTAGG - Intergenic
978175297 4:105723473-105723495 CACAGTGTTTATATTGTATTAGG + Intronic
978305615 4:107324758-107324780 CATAATATTTACATTGTGTTAGG - Intergenic
978358411 4:107902478-107902500 CAGTATGATTAAATTGTAATGGG + Intronic
979568240 4:122182056-122182078 AAGAATATTTAAATTGTTTTTGG - Intronic
979606944 4:122648594-122648616 CATAACATTTACATTGTATTAGG - Intergenic
979741082 4:124151886-124151908 CAGAATAACAAGCTTGTATTTGG + Intergenic
979910962 4:126365170-126365192 AAGAATAATCAAATTGAATTAGG + Intergenic
980228817 4:130021579-130021601 CATAATATTTACAGTGTATTTGG - Intergenic
980262172 4:130464128-130464150 CAGAAAAATTATATTCAATAAGG - Intergenic
980582076 4:134768515-134768537 CAGAATAGTTGTATTTTGTTAGG - Intergenic
980665044 4:135922311-135922333 CTAAATAACTATATTGTAGTAGG - Intergenic
980673132 4:136036569-136036591 CACATTAATTATACTATATTTGG - Intergenic
980676331 4:136087653-136087675 CATAGTAATTATTTTGGATTTGG - Intergenic
980731534 4:136830796-136830818 AAGAATACTTATATTGGATTAGG - Intergenic
980738648 4:136922400-136922422 CATAATATTTAAATTTTATTTGG - Intergenic
980868809 4:138586462-138586484 CAGAAAAATTATATTCTCGTGGG + Intergenic
980947189 4:139333062-139333084 CACAGTATTTACATTGTATTAGG - Intronic
981703851 4:147638898-147638920 TAGAATAATTATCTTAAATTAGG - Intronic
982045098 4:151436942-151436964 CATAGTATTTAGATTGTATTAGG - Intronic
982283062 4:153705676-153705698 CATAGTATTTACATTGTATTGGG - Exonic
982376882 4:154701545-154701567 CATAACATTTACATTGTATTGGG - Intronic
982439582 4:155419727-155419749 GAAAATGTTTATATTGTATTCGG - Intergenic
982978694 4:162103057-162103079 TATAATAATCATATTGTTTTGGG + Intronic
982997010 4:162362091-162362113 CATAACAATTACATTGTATTAGG + Intergenic
983203732 4:164889862-164889884 CATACCATTTATATTGTATTAGG + Intronic
983206573 4:164916747-164916769 CAGAATAATTATATTGTATTGGG + Intergenic
983212050 4:164968801-164968823 CAGAATAATTATATTGTATTGGG - Intronic
983278033 4:165642651-165642673 GAGAAAAAGTATATTGGATTTGG - Intergenic
983769700 4:171534416-171534438 CAAGGTAATTATATGGTATTAGG + Intergenic
984287287 4:177747591-177747613 CTGAATAATTATAATTCATTGGG - Intronic
985274349 4:188223331-188223353 CATAGTATTTACATTGTATTAGG - Intergenic
986519946 5:8604651-8604673 CAGAATAATGACATAGCATTTGG + Intergenic
986694781 5:10342032-10342054 CATAACATTTACATTGTATTAGG - Intergenic
986837699 5:11659196-11659218 CATAGTATTTACATTGTATTAGG + Intronic
986894113 5:12345260-12345282 CTGAATCAATATATTTTATTTGG - Intergenic
987953879 5:24712279-24712301 CAAAATATTTACATTGTATTAGG + Intergenic
988188036 5:27891953-27891975 CATAATATTTGTATTGTATCGGG - Intergenic
988213044 5:28232001-28232023 TAGAATTAATATATTCTATTAGG + Intergenic
988963818 5:36395230-36395252 CATAGTATTTACATTGTATTAGG - Intergenic
989085337 5:37670485-37670507 CAGCAAAATTATATTGTAAAGGG + Intronic
989174902 5:38514812-38514834 CACAACACTTACATTGTATTAGG + Intronic
989201186 5:38765354-38765376 CAAATTAATTTAATTGTATTTGG - Intergenic
989455918 5:41644169-41644191 TAGAATAATTATATTCCTTTTGG - Intergenic
989514234 5:42323129-42323151 TATAATAATAATATTGTAGTAGG + Intergenic
990033186 5:51286797-51286819 GAGAATATTAATATTGTATCAGG + Intergenic
990134054 5:52623598-52623620 CTGAATATATATTTTGTATTTGG - Intergenic
990219069 5:53566728-53566750 CAGAGAATTTACATTGTATTAGG - Intronic
990795068 5:59530507-59530529 CATAACATTTACATTGTATTAGG - Intronic
991300850 5:65127927-65127949 CAAAATATTTATATTTTTTTAGG - Intergenic
991366370 5:65872123-65872145 CAAAATAATTATTTTGGATGAGG - Intergenic
992247419 5:74840344-74840366 TGGAATAATTTTATTGTCTTAGG + Intronic
992535062 5:77692428-77692450 AATAATAATAATAATGTATTTGG - Intronic
992671341 5:79063979-79064001 CAGAATCATTATATGGAATGGGG - Intronic
993013402 5:82509221-82509243 CATAACATTTATATTATATTAGG - Intergenic
993314864 5:86389470-86389492 AAGAATATTTATGTTGAATTTGG - Intergenic
993357013 5:86926575-86926597 CAGAAAAACTATAGTGTCTTAGG - Intergenic
994453388 5:99973129-99973151 CAGAATAATTAAAATTTATCAGG - Intergenic
994456813 5:100019906-100019928 CATAACTATTACATTGTATTAGG + Intergenic
994589112 5:101751818-101751840 CATAGTATTTATACTGTATTAGG + Intergenic
994808967 5:104488722-104488744 CATAATATATACATTGTATTAGG - Intergenic
994838687 5:104892391-104892413 AAGAATAGTTATATTGTATTAGG - Intergenic
995100871 5:108303544-108303566 CAGAATACATATGTTGTATGTGG - Intronic
995104852 5:108365162-108365184 TATAATAATAATATTGTAATTGG + Intronic
996372108 5:122764332-122764354 CTGAGAAATTATATTGTAATTGG - Intergenic
996586952 5:125099827-125099849 AAGAATATTCATATTATATTTGG + Intergenic
997007131 5:129831283-129831305 CCAAATAATTATTTTGTTTTAGG + Intergenic
997785767 5:136711848-136711870 CATAACATTTAAATTGTATTAGG + Intergenic
998035619 5:138912888-138912910 CAGATTAAATATACAGTATTAGG - Intronic
998254872 5:140577472-140577494 CATAACATTTACATTGTATTAGG + Intronic
998679982 5:144456210-144456232 CAGCAAAATTATATTTTGTTGGG - Intronic
998982956 5:147725104-147725126 TACATTAATTATAATGTATTAGG + Intronic
999031030 5:148291267-148291289 CACAATTATTCTATTGTAGTAGG + Intergenic
999633829 5:153599559-153599581 CATAGTATTTACATTGTATTAGG - Intronic
999991567 5:157054802-157054824 CATAGTATTTACATTGTATTCGG + Intronic
1000206733 5:159067876-159067898 CAGGATAATTATTGTGTTTTTGG - Intronic
1000462312 5:161537893-161537915 CAGGATAAATAAATGGTATTAGG - Intronic
1000467547 5:161598581-161598603 TAGTAAAATTGTATTGTATTAGG + Intronic
1000567204 5:162863959-162863981 CAGCATAATTACATTATTTTTGG + Intergenic
1001508882 5:172303435-172303457 CAGAAGAATTATTTTGTGTAAGG - Intergenic
1001762215 5:174217516-174217538 CAGAATAATTAAAATCCATTAGG - Intronic
1002984330 6:2174009-2174031 CTCAATAATTATAATGTATTGGG - Intronic
1003379492 6:5610503-5610525 CATAACATTTACATTGTATTAGG + Intronic
1003756243 6:9123896-9123918 AGGAATTTTTATATTGTATTAGG + Intergenic
1003783202 6:9452653-9452675 CATAATCATTATATAGTCTTAGG - Intergenic
1003811452 6:9786970-9786992 CATTATAATCATATTATATTAGG - Intronic
1004040877 6:11973888-11973910 CAGAATCACTTTATTGTATTTGG - Intergenic
1004109043 6:12696682-12696704 CACAGCATTTATATTGTATTAGG - Intergenic
1004226792 6:13792585-13792607 CAGTTTAACTGTATTGTATTTGG - Intronic
1004395003 6:15239971-15239993 AAGCATCATTTTATTGTATTTGG + Intergenic
1005201888 6:23355907-23355929 TAAGCTAATTATATTGTATTGGG + Intergenic
1005201894 6:23355934-23355956 GACACCAATTATATTGTATTGGG - Intergenic
1005696700 6:28358390-28358412 CAAAACATTTACATTGTATTTGG - Intronic
1006976925 6:38111374-38111396 CATAGTGTTTATATTGTATTAGG + Intronic
1007334853 6:41148410-41148432 TATAACATTTATATTGTATTAGG - Intergenic
1008578553 6:52884362-52884384 CAGAGAAAATAAATTGTATTAGG + Intronic
1008906915 6:56688096-56688118 TAGAATAATTGTATAGAATTTGG - Intronic
1009552596 6:65118355-65118377 CAGAATATTTTAAATGTATTTGG - Intronic
1009843962 6:69112718-69112740 CATAATCTTTACATTGTATTAGG + Intronic
1010963107 6:82169564-82169586 CAGAATAATGTTATTTTGTTAGG + Intergenic
1010979798 6:82358882-82358904 CATAACATTTACATTGTATTAGG - Intergenic
1011130246 6:84045018-84045040 CATAGCATTTATATTGTATTAGG + Intronic
1011190977 6:84728043-84728065 CAGATTAATAAAACTGTATTTGG - Intronic
1011345344 6:86363467-86363489 CAGACTATTTACATTGTGTTAGG - Intergenic
1011593349 6:88992456-88992478 CATAATATTGATATTATATTGGG + Intergenic
1012370638 6:98502379-98502401 AAGAATAATTATATTAATTTAGG + Intergenic
1012868587 6:104646483-104646505 CATAGTATTTACATTGTATTAGG + Intergenic
1012948752 6:105495491-105495513 CAGAATAAACAGAATGTATTGGG - Intergenic
1014979933 6:127933628-127933650 CAGTATTATTATATTGTATTTGG - Intergenic
1015048858 6:128814245-128814267 CACTATAATTATTTTATATTGGG - Intergenic
1015656011 6:135519918-135519940 CAGAATAATTATCATGTTCTGGG + Intergenic
1016001258 6:139043768-139043790 CAAAATAAATATTTTGTATAGGG - Intergenic
1016521565 6:144952385-144952407 CATAGTATTTATGTTGTATTAGG - Intergenic
1016698632 6:147028856-147028878 GAGCTTAATTATATTGTACTGGG - Intergenic
1017342364 6:153339593-153339615 GAGAGGAACTATATTGTATTTGG + Intergenic
1017603628 6:156110188-156110210 CACATTAATTGTTTTGTATTAGG - Intergenic
1017869486 6:158474752-158474774 CAGAATATTTGCATTGTATCAGG + Intronic
1018103372 6:160461090-160461112 AAAAATAATTATATTATTTTAGG - Intergenic
1018157920 6:161006438-161006460 CATAGTAATTATGTTGTATTAGG + Intronic
1018222880 6:161598941-161598963 GACAAGAGTTATATTGTATTAGG - Intronic
1018302316 6:162416503-162416525 CTGAGTAAGTATATTTTATTTGG + Intronic
1018405320 6:163475386-163475408 CACAGTATTTACATTGTATTAGG + Intronic
1020903640 7:14037899-14037921 CAGAGTAATTACATTATATTAGG + Intergenic
1021095633 7:16532473-16532495 CAGATTAATTATATGTTATCAGG + Exonic
1021151381 7:17155013-17155035 TATAATATTTACATTGTATTAGG + Intergenic
1021436512 7:20623844-20623866 CATAATAATTGTGTTATATTTGG + Intronic
1021480431 7:21109577-21109599 CATAGTATTTACATTGTATTAGG + Intergenic
1022099856 7:27162443-27162465 AAGAATCAATATATTTTATTTGG + Exonic
1022122464 7:27322827-27322849 AATAATTATTATACTGTATTGGG - Intergenic
1022636465 7:32140888-32140910 CAGAATAATTATATGCTAAGTGG + Intronic
1022751305 7:33229231-33229253 TAATAAAATTATATTGTATTTGG - Intronic
1023039165 7:36157061-36157083 CATAACATTTACATTGTATTAGG + Intronic
1023165543 7:37339816-37339838 CAGAATAATTATCAAGAATTAGG + Intronic
1023253278 7:38287964-38287986 CATAGTATTTACATTGTATTAGG - Intergenic
1023364346 7:39448781-39448803 CTGAATCATTAGATTGTCTTCGG - Intronic
1023677074 7:42642109-42642131 AAGAATAATGATATAGTTTTGGG - Intergenic
1023978300 7:45049929-45049951 CATAACATTTACATTGTATTAGG + Intronic
1025641239 7:63371973-63371995 AAGATTAATTATTTTGTATCTGG - Intergenic
1026051960 7:66954262-66954284 CATAGTATTTACATTGTATTAGG - Intronic
1026255449 7:68707300-68707322 CAGATTAATCATACTGTATTTGG + Intergenic
1026818133 7:73528247-73528269 CAAAAGAATTATATTGCAATTGG + Intergenic
1027344217 7:77240548-77240570 CATAGCATTTATATTGTATTAGG - Intronic
1027405615 7:77856734-77856756 CAGAACAGTTATAATGTATTAGG + Intronic
1027797118 7:82709772-82709794 CATAACATCTATATTGTATTAGG + Intergenic
1027805238 7:82811674-82811696 CAGTATAATTATTATCTATTTGG + Intronic
1028144022 7:87302013-87302035 GAGAATTATTATATTCTTTTGGG + Intergenic
1028360355 7:89960115-89960137 TAGAATAATTGTATTATGTTAGG - Intergenic
1028434733 7:90789556-90789578 CATAGTGTTTATATTGTATTAGG + Intronic
1028933893 7:96444272-96444294 CATAGTATTTACATTGTATTTGG + Intergenic
1030380084 7:108801748-108801770 AAGAAAAAATGTATTGTATTTGG + Intergenic
1030551144 7:110961355-110961377 CATAGCATTTATATTGTATTAGG - Intronic
1030704057 7:112673077-112673099 ATGAATAATGAGATTGTATTTGG - Intergenic
1031415281 7:121488790-121488812 CAATATAGTTATAATGTATTTGG - Intergenic
1031466893 7:122124066-122124088 CAGTATAATTAGAGTGTATATGG - Intronic
1031831795 7:126636431-126636453 CATAATATTTACCTTGTATTAGG - Intronic
1031940378 7:127782575-127782597 CAGAATAATGATTTTTAATTTGG + Intronic
1032063185 7:128742521-128742543 CAGAATACTTAAATTGTTTCAGG - Intronic
1032369655 7:131334132-131334154 TAGAATATATTTATTGTATTTGG + Intronic
1032941089 7:136793020-136793042 CAAAATAATTATATGGTTTGTGG - Intergenic
1032960507 7:137028174-137028196 AAGAATAATTATATTCTATCTGG - Intergenic
1033224603 7:139550808-139550830 CATAGTATTTACATTGTATTAGG + Intergenic
1033949413 7:146765059-146765081 CAGAATGAAAATATTATATTAGG + Intronic
1033990766 7:147283479-147283501 TAGCACAATTATATTGTTTTTGG - Intronic
1034153538 7:148935971-148935993 TACAATATTTACATTGTATTAGG - Intergenic
1034189541 7:149203281-149203303 CAGAATAATGAAATGGTTTTGGG + Intronic
1034589952 7:152130548-152130570 CATATTAATGATATAGTATTTGG - Intergenic
1036909055 8:12737455-12737477 CATAGTATTTACATTGTATTAGG + Intronic
1036968974 8:13332818-13332840 CAGAATTAATATAGTTTATTTGG + Intronic
1037008887 8:13816655-13816677 CACAGTATTTAAATTGTATTAGG + Intergenic
1037052056 8:14385970-14385992 CATAGTATTTACATTGTATTTGG - Intronic
1037234657 8:16703781-16703803 AAGAATCATTATATGGTTTTGGG - Intergenic
1037350760 8:17952597-17952619 CATAGTGTTTATATTGTATTAGG + Intronic
1037604630 8:20427069-20427091 CAGAATAATTCTAGTTTATCTGG + Intergenic
1038964648 8:32558280-32558302 CAGAATAAATATTATGCATTCGG + Intronic
1039165374 8:34673529-34673551 CATAAAAATTATATTGTAATAGG + Intergenic
1039339610 8:36633001-36633023 CAATCTAATTATATTGTCTTAGG - Intergenic
1039342223 8:36663416-36663438 TAGAATAATTTTATTGTGTTAGG + Intergenic
1039398953 8:37252336-37252358 GAGAAAAAATATATTGGATTTGG + Intergenic
1039675734 8:39664301-39664323 CATAGCATTTATATTGTATTAGG + Intronic
1040426234 8:47289458-47289480 CAGAATAATTGATTTTTATTAGG + Intronic
1040869113 8:52082080-52082102 GATAACATTTATATTGTATTAGG + Intergenic
1041438878 8:57872370-57872392 GAAAATAATTTTATTGTATAAGG - Intergenic
1041461634 8:58118170-58118192 GAGAAGAAATATATTGAATTGGG - Intronic
1041538580 8:58956592-58956614 AATAATAATAATATAGTATTTGG - Intronic
1041603088 8:59745371-59745393 CAGAAAATTTCTATTTTATTTGG - Intergenic
1041851022 8:62393399-62393421 CACAATTATTATATTGTAGATGG - Intronic
1042016190 8:64315592-64315614 TAATAAAATTATATTGTATTTGG + Intergenic
1042597889 8:70469223-70469245 TAGAATTATTTTATTGGATTTGG - Intergenic
1042799645 8:72704900-72704922 CATAACATTTACATTGTATTAGG - Intronic
1042813846 8:72855947-72855969 CAGAGCATTTACATTGTATTAGG - Intronic
1043163873 8:76879172-76879194 CAGGATAGTTATTTTATATTAGG - Intergenic
1043276935 8:78409469-78409491 CAGTATTATTATTTTTTATTTGG - Intergenic
1043681764 8:83036397-83036419 CATAGCATTTATATTGTATTAGG + Intergenic
1044145391 8:88707445-88707467 CAGAAAAACTAGATTTTATTTGG + Intergenic
1044391127 8:91652753-91652775 CAGAATAAATATTTTGGTTTGGG - Intergenic
1045169700 8:99650946-99650968 CATAGCACTTATATTGTATTAGG + Intronic
1045179109 8:99760855-99760877 CATAGTATTTACATTGTATTAGG + Intronic
1045211071 8:100100223-100100245 CATAACATTTACATTGTATTAGG - Intronic
1045740372 8:105351273-105351295 CATAGTATTTACATTGTATTAGG - Intronic
1045830693 8:106457155-106457177 CACAATAATTACTTTGGATTAGG + Intronic
1046350741 8:113007378-113007400 CACACTAATTATATTGGATTAGG - Intronic
1046518541 8:115294717-115294739 CATAACACTTACATTGTATTAGG + Intergenic
1047042970 8:121019087-121019109 CAGAAGTATGATATTCTATTAGG + Intergenic
1047820603 8:128515964-128515986 CATATTAATATTATTGTATTAGG + Intergenic
1048228029 8:132609291-132609313 CATAACATTTACATTGTATTAGG - Intronic
1048254107 8:132892412-132892434 GAGAATAAGAATATTTTATTGGG + Intronic
1048325958 8:133439201-133439223 AATAATATTTACATTGTATTAGG + Intergenic
1048952226 8:139505649-139505671 CAGCAGAATTCTATTGCATTAGG - Intergenic
1050381835 9:5039369-5039391 CATAACATTTACATTGTATTAGG + Intronic
1050629871 9:7547559-7547581 CATAGTATTTACATTGTATTAGG + Intergenic
1050704245 9:8378745-8378767 AAATATAATTATATTGAATTTGG - Intronic
1051018020 9:12504922-12504944 CAGAATAATCTGATTGAATTGGG + Intergenic
1051397001 9:16633897-16633919 AAAAATAATTATAATATATTTGG - Intronic
1051895600 9:21984631-21984653 CAGATAAATAATAATGTATTCGG + Intronic
1052133605 9:24882701-24882723 CAAAAGCATAATATTGTATTTGG - Intergenic
1052154998 9:25175713-25175735 CAGAGGAAATTTATTGTATTAGG + Intergenic
1052462441 9:28783350-28783372 CACAGCATTTATATTGTATTAGG - Intergenic
1052475472 9:28954021-28954043 CCGAATAATTTTAAAGTATTGGG + Intergenic
1052662616 9:31454914-31454936 CATAACATTTACATTGTATTAGG - Intergenic
1052759578 9:32576622-32576644 CAGAGTATTGACATTGTATTAGG + Intergenic
1052809083 9:33041096-33041118 CATAGTACTTACATTGTATTAGG + Intergenic
1053363487 9:37506153-37506175 CAGAATAATGGGATTGTACTAGG + Intergenic
1053553532 9:39109302-39109324 CAGAATAATTTTAATGGTTTCGG - Intronic
1053674508 9:40410308-40410330 CAGAGCATTTACATTGTATTAGG + Intergenic
1053817645 9:41929459-41929481 CAGAATAATTTTAATGGTTTCGG - Intronic
1053924299 9:43036672-43036694 CAGAGCATTTACATTGTATTAGG + Intergenic
1054107898 9:61073131-61073153 CAGAATAATTTTAATGGTTTCGG - Intergenic
1054385615 9:64550372-64550394 CAGAGCATTTACATTGTATTAGG + Intergenic
1054510111 9:65965983-65966005 CAGAGCATTTACATTGTATTAGG - Intergenic
1054612959 9:67257994-67258016 CAGAATAATTTTAATGGTTTCGG + Intergenic
1055045534 9:71920174-71920196 CAAAAAAATTATATTATATCAGG - Intronic
1055107654 9:72529003-72529025 CAGAGCATTCATATTGTATTAGG + Intronic
1055329223 9:75164614-75164636 ATGAATAATTATATAGTAATTGG - Intergenic
1056160524 9:83886856-83886878 CAGAAGAATTTTGTTGTTTTGGG - Intronic
1057005273 9:91551889-91551911 AATAATTATTATACTGTATTGGG - Intergenic
1057079938 9:92166292-92166314 AAAAATAATTATATAGTAATGGG + Intergenic
1057503195 9:95611927-95611949 GAAAATAATTACATTTTATTTGG + Intergenic
1058287353 9:103195291-103195313 CATACTAATTATAATGCATTTGG + Intergenic
1058325424 9:103690562-103690584 CATAGCAATTACATTGTATTTGG + Intergenic
1058414174 9:104768037-104768059 CATAGTATCTATATTGTATTAGG - Intronic
1058468083 9:105248386-105248408 CAAAATAATTATACTGTTTTAGG + Intronic
1058497209 9:105572121-105572143 CAAAATAATTATGATTTATTAGG + Intronic
1059026860 9:110643970-110643992 CAGAATGTTCATATTTTATTAGG + Intergenic
1059133326 9:111778154-111778176 CAGAATAAATATATTGGACAGGG - Intronic
1059188746 9:112303154-112303176 CAGAATAAGTATGATTTATTTGG - Intronic
1059255835 9:112929830-112929852 CAAAATAATTATTTTTAATTTGG - Intergenic
1059505277 9:114793042-114793064 CAGAAATATTATGTTGGATTAGG + Intronic
1060358893 9:122936084-122936106 CAGCTTAATTATAATATATTTGG + Intergenic
1061598956 9:131653256-131653278 CATAACATTTACATTGTATTTGG - Intronic
1203532658 Un_GL000213v1:162196-162218 CATAGCATTTATATTGTATTAGG + Intergenic
1185880498 X:3735852-3735874 CAAAACAATTACACTGTATTAGG + Intergenic
1186681030 X:11874464-11874486 CACAGCATTTATATTGTATTAGG + Intergenic
1186979068 X:14939652-14939674 CAGACTAATTAGATTGTTTAAGG + Intergenic
1188135427 X:26488694-26488716 GAGAAAAAATATCTTGTATTTGG - Intergenic
1188638788 X:32471608-32471630 CATAATATTTACATTGTATTAGG + Intronic
1188663023 X:32783653-32783675 CGTACTATTTATATTGTATTAGG + Intronic
1188796583 X:34473961-34473983 CAGAAAAATTATATAGTGTTAGG - Intergenic
1190974783 X:55388675-55388697 CATAGTATTTACATTGTATTGGG + Intergenic
1191021012 X:55859958-55859980 CAGATTAATTATCTTAGATTGGG - Intergenic
1192845347 X:74901644-74901666 CAGGAAAACTATATTTTATTAGG - Intronic
1193138602 X:78001247-78001269 TAGAAAAATTAGATTATATTAGG + Intronic
1193142102 X:78038280-78038302 CAGAGTCATCATATGGTATTAGG + Intronic
1193837931 X:86369064-86369086 CAAAATAGTTTTATTCTATTAGG + Intronic
1194358964 X:92923700-92923722 CATAGTATTTATATTGTATTAGG + Intergenic
1194452616 X:94063085-94063107 TAAAAAAATTGTATTGTATTGGG + Intergenic
1194482868 X:94448369-94448391 CAGTATAGTTGTATTATATTAGG + Intergenic
1194555761 X:95356806-95356828 CATAGGATTTATATTGTATTAGG + Intergenic
1195756911 X:108207721-108207743 CATAGTATTTACATTGTATTAGG + Intronic
1196336367 X:114540867-114540889 TAAAATAATTACATAGTATTTGG - Intergenic
1196354930 X:114780072-114780094 CATAAGATTTACATTGTATTAGG + Intronic
1196486720 X:116219032-116219054 TAGAATAATTATATTTCTTTGGG - Intergenic
1197530217 X:127614254-127614276 TAAAATAATTAAATTCTATTTGG - Intergenic
1197571232 X:128153298-128153320 TAGAATAATTATATTCCTTTGGG - Intergenic
1197666352 X:129228203-129228225 CATAACATTTATATTCTATTAGG + Intergenic
1198014605 X:132596086-132596108 CATAACATTTATAGTGTATTCGG + Intergenic
1198268029 X:135028795-135028817 CATAGCATTTATATTGTATTAGG + Intergenic
1198949295 X:142052068-142052090 CAGAATATCTACATTGTTTTAGG + Intergenic
1199225931 X:145373969-145373991 CAGACTTTTTATATTGTACTAGG - Intergenic
1199365451 X:146975671-146975693 AAGAAAAATAATAATGTATTGGG + Intergenic
1199603481 X:149557797-149557819 CAGTATAATTATGTGGCATTCGG + Intergenic
1199646906 X:149921678-149921700 CAGTATAATTATGTGGCATTCGG - Intergenic
1199714168 X:150494501-150494523 CAGAATAATTATCTTGGATCAGG - Intronic
1199789240 X:151136019-151136041 AAGAATAATTATGTTTAATTCGG - Intergenic
1199840652 X:151644225-151644247 CAGTGTAGTTATTTTGTATTCGG + Intronic
1200667179 Y:6039705-6039727 CATAGTATTTATATTGTATTAGG + Intergenic
1200871701 Y:8106767-8106789 AAGAAAAGTTGTATTGTATTAGG + Intergenic
1200889111 Y:8303953-8303975 AAGAATAGTTGTATTATATTAGG - Intergenic
1202244288 Y:22802391-22802413 AAGAATAGTTGTATTATATTAGG - Intergenic
1202397276 Y:24436137-24436159 AAGAATAGTTGTATTATATTAGG - Intergenic
1202473505 Y:25233951-25233973 AAGAATAGTTGTATTATATTAGG + Intergenic