ID: 983208666

View in Genome Browser
Species Human (GRCh38)
Location 4:164936402-164936424
Sequence GGTGGAGCTGCTGAGTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983208666_983208671 22 Left 983208666 4:164936402-164936424 CCACTGCACTCAGCAGCTCCACC No data
Right 983208671 4:164936447-164936469 AACAGCGTTTCTCCCTCCAGAGG No data
983208666_983208669 -1 Left 983208666 4:164936402-164936424 CCACTGCACTCAGCAGCTCCACC No data
Right 983208669 4:164936424-164936446 CTCTGCTCTTTAGCCATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983208666 Original CRISPR GGTGGAGCTGCTGAGTGCAG TGG (reversed) Intergenic