ID: 983208667

View in Genome Browser
Species Human (GRCh38)
Location 4:164936420-164936442
Sequence ACATGGCTAAAGAGCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983208667_983208671 4 Left 983208667 4:164936420-164936442 CCACCTCTGCTCTTTAGCCATGT No data
Right 983208671 4:164936447-164936469 AACAGCGTTTCTCCCTCCAGAGG No data
983208667_983208674 19 Left 983208667 4:164936420-164936442 CCACCTCTGCTCTTTAGCCATGT No data
Right 983208674 4:164936462-164936484 TCCAGAGGCTGCAGCATTGAAGG No data
983208667_983208676 30 Left 983208667 4:164936420-164936442 CCACCTCTGCTCTTTAGCCATGT No data
Right 983208676 4:164936473-164936495 CAGCATTGAAGGCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983208667 Original CRISPR ACATGGCTAAAGAGCAGAGG TGG (reversed) Intergenic