ID: 983208668

View in Genome Browser
Species Human (GRCh38)
Location 4:164936423-164936445
Sequence CTGACATGGCTAAAGAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983208668_983208676 27 Left 983208668 4:164936423-164936445 CCTCTGCTCTTTAGCCATGTCAG No data
Right 983208676 4:164936473-164936495 CAGCATTGAAGGCACCATCTTGG No data
983208668_983208674 16 Left 983208668 4:164936423-164936445 CCTCTGCTCTTTAGCCATGTCAG No data
Right 983208674 4:164936462-164936484 TCCAGAGGCTGCAGCATTGAAGG No data
983208668_983208671 1 Left 983208668 4:164936423-164936445 CCTCTGCTCTTTAGCCATGTCAG No data
Right 983208671 4:164936447-164936469 AACAGCGTTTCTCCCTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983208668 Original CRISPR CTGACATGGCTAAAGAGCAG AGG (reversed) Intergenic