ID: 983208670

View in Genome Browser
Species Human (GRCh38)
Location 4:164936437-164936459
Sequence GAGAAACGCTGTTCCTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983208670_983208678 27 Left 983208670 4:164936437-164936459 CCATGTCAGGAACAGCGTTTCTC No data
Right 983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG No data
983208670_983208674 2 Left 983208670 4:164936437-164936459 CCATGTCAGGAACAGCGTTTCTC No data
Right 983208674 4:164936462-164936484 TCCAGAGGCTGCAGCATTGAAGG No data
983208670_983208676 13 Left 983208670 4:164936437-164936459 CCATGTCAGGAACAGCGTTTCTC No data
Right 983208676 4:164936473-164936495 CAGCATTGAAGGCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983208670 Original CRISPR GAGAAACGCTGTTCCTGACA TGG (reversed) Intergenic