ID: 983208671

View in Genome Browser
Species Human (GRCh38)
Location 4:164936447-164936469
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983208667_983208671 4 Left 983208667 4:164936420-164936442 CCACCTCTGCTCTTTAGCCATGT No data
Right 983208671 4:164936447-164936469 AACAGCGTTTCTCCCTCCAGAGG No data
983208668_983208671 1 Left 983208668 4:164936423-164936445 CCTCTGCTCTTTAGCCATGTCAG No data
Right 983208671 4:164936447-164936469 AACAGCGTTTCTCCCTCCAGAGG No data
983208666_983208671 22 Left 983208666 4:164936402-164936424 CCACTGCACTCAGCAGCTCCACC 0: 1
1: 0
2: 2
3: 44
4: 649
Right 983208671 4:164936447-164936469 AACAGCGTTTCTCCCTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type