ID: 983208672 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:164936459-164936481 |
| Sequence | TCAATGCTGCAGCCTCTGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 366 | |||
| Summary | {0: 1, 1: 0, 2: 12, 3: 52, 4: 301} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 983208672_983208678 | 5 | Left | 983208672 | 4:164936459-164936481 | CCCTCCAGAGGCTGCAGCATTGA | 0: 1 1: 0 2: 12 3: 52 4: 301 |
||
| Right | 983208678 | 4:164936487-164936509 | CCATCTTGGAAGCAGAGACCAGG | No data | ||||
| 983208672_983208676 | -9 | Left | 983208672 | 4:164936459-164936481 | CCCTCCAGAGGCTGCAGCATTGA | 0: 1 1: 0 2: 12 3: 52 4: 301 |
||
| Right | 983208676 | 4:164936473-164936495 | CAGCATTGAAGGCACCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 983208672 | Original CRISPR | TCAATGCTGCAGCCTCTGGA GGG (reversed) | Intergenic | ||