ID: 983208672

View in Genome Browser
Species Human (GRCh38)
Location 4:164936459-164936481
Sequence TCAATGCTGCAGCCTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983208672_983208678 5 Left 983208672 4:164936459-164936481 CCCTCCAGAGGCTGCAGCATTGA No data
Right 983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG 0: 28
1: 95
2: 144
3: 181
4: 371
983208672_983208676 -9 Left 983208672 4:164936459-164936481 CCCTCCAGAGGCTGCAGCATTGA No data
Right 983208676 4:164936473-164936495 CAGCATTGAAGGCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983208672 Original CRISPR TCAATGCTGCAGCCTCTGGA GGG (reversed) Intergenic
No off target data available for this crispr