ID: 983208673

View in Genome Browser
Species Human (GRCh38)
Location 4:164936460-164936482
Sequence TTCAATGCTGCAGCCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983208673_983208678 4 Left 983208673 4:164936460-164936482 CCTCCAGAGGCTGCAGCATTGAA No data
Right 983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG No data
983208673_983208676 -10 Left 983208673 4:164936460-164936482 CCTCCAGAGGCTGCAGCATTGAA No data
Right 983208676 4:164936473-164936495 CAGCATTGAAGGCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983208673 Original CRISPR TTCAATGCTGCAGCCTCTGG AGG (reversed) Intergenic