ID: 983208673 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:164936460-164936482 |
| Sequence | TTCAATGCTGCAGCCTCTGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 983208673_983208676 | -10 | Left | 983208673 | 4:164936460-164936482 | CCTCCAGAGGCTGCAGCATTGAA | No data | ||
| Right | 983208676 | 4:164936473-164936495 | CAGCATTGAAGGCACCATCTTGG | No data | ||||
| 983208673_983208678 | 4 | Left | 983208673 | 4:164936460-164936482 | CCTCCAGAGGCTGCAGCATTGAA | No data | ||
| Right | 983208678 | 4:164936487-164936509 | CCATCTTGGAAGCAGAGACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 983208673 | Original CRISPR | TTCAATGCTGCAGCCTCTGG AGG (reversed) | Intergenic | ||