ID: 983208674

View in Genome Browser
Species Human (GRCh38)
Location 4:164936462-164936484
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983208670_983208674 2 Left 983208670 4:164936437-164936459 CCATGTCAGGAACAGCGTTTCTC No data
Right 983208674 4:164936462-164936484 TCCAGAGGCTGCAGCATTGAAGG No data
983208668_983208674 16 Left 983208668 4:164936423-164936445 CCTCTGCTCTTTAGCCATGTCAG No data
Right 983208674 4:164936462-164936484 TCCAGAGGCTGCAGCATTGAAGG No data
983208667_983208674 19 Left 983208667 4:164936420-164936442 CCACCTCTGCTCTTTAGCCATGT No data
Right 983208674 4:164936462-164936484 TCCAGAGGCTGCAGCATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type