ID: 983208676

View in Genome Browser
Species Human (GRCh38)
Location 4:164936473-164936495
Sequence CAGCATTGAAGGCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983208672_983208676 -9 Left 983208672 4:164936459-164936481 CCCTCCAGAGGCTGCAGCATTGA No data
Right 983208676 4:164936473-164936495 CAGCATTGAAGGCACCATCTTGG No data
983208668_983208676 27 Left 983208668 4:164936423-164936445 CCTCTGCTCTTTAGCCATGTCAG No data
Right 983208676 4:164936473-164936495 CAGCATTGAAGGCACCATCTTGG No data
983208667_983208676 30 Left 983208667 4:164936420-164936442 CCACCTCTGCTCTTTAGCCATGT No data
Right 983208676 4:164936473-164936495 CAGCATTGAAGGCACCATCTTGG No data
983208670_983208676 13 Left 983208670 4:164936437-164936459 CCATGTCAGGAACAGCGTTTCTC No data
Right 983208676 4:164936473-164936495 CAGCATTGAAGGCACCATCTTGG No data
983208673_983208676 -10 Left 983208673 4:164936460-164936482 CCTCCAGAGGCTGCAGCATTGAA No data
Right 983208676 4:164936473-164936495 CAGCATTGAAGGCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983208676 Original CRISPR CAGCATTGAAGGCACCATCT TGG Intergenic
No off target data available for this crispr