ID: 983208678

View in Genome Browser
Species Human (GRCh38)
Location 4:164936487-164936509
Sequence CCATCTTGGAAGCAGAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 28, 1: 95, 2: 144, 3: 181, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983208673_983208678 4 Left 983208673 4:164936460-164936482 CCTCCAGAGGCTGCAGCATTGAA No data
Right 983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG 0: 28
1: 95
2: 144
3: 181
4: 371
983208675_983208678 1 Left 983208675 4:164936463-164936485 CCAGAGGCTGCAGCATTGAAGGC No data
Right 983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG 0: 28
1: 95
2: 144
3: 181
4: 371
983208672_983208678 5 Left 983208672 4:164936459-164936481 CCCTCCAGAGGCTGCAGCATTGA No data
Right 983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG 0: 28
1: 95
2: 144
3: 181
4: 371
983208670_983208678 27 Left 983208670 4:164936437-164936459 CCATGTCAGGAACAGCGTTTCTC No data
Right 983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG 0: 28
1: 95
2: 144
3: 181
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983208678 Original CRISPR CCATCTTGGAAGCAGAGACC AGG Intergenic
900330158 1:2130263-2130285 CCAGCTGGAAAGCAGGGACCAGG - Intronic
900339969 1:2183672-2183694 CCATCTTGGAAGCAGAGATCAGG - Intronic
900494725 1:2971255-2971277 CCACCTCTGAGGCAGAGACCTGG + Intergenic
901021111 1:6256246-6256268 CCATCTTTGAAGCACAGACCAGG + Intronic
901974311 1:12932267-12932289 CCACCTTGGATGCAAAGACAAGG - Intronic
902537120 1:17125949-17125971 CCATCTTGGAAGCAGGGAGGCGG + Intergenic
902966905 1:20011838-20011860 CCATCTTGGTAGCAGAGACCAGG - Intergenic
902967165 1:20013994-20014016 CCATCTTAGAAGCAAAGACCAGG - Intergenic
903050665 1:20598346-20598368 CCATCTTGGAAGCTGAGACTGGG + Intronic
903394155 1:22986483-22986505 CCATCTTGAAAGCAGACACCGGG + Intergenic
903406033 1:23097059-23097081 TCATCTTGGAAGCAGAGACTGGG - Intronic
903544542 1:24115686-24115708 CCATCTATGATGCAGAGAGCAGG - Intergenic
903714695 1:25356242-25356264 GCAACTGGGCAGCAGAGACCTGG - Intronic
903973205 1:27132727-27132749 TCATCCTGAAAGCAGATACCAGG + Intronic
904275359 1:29380317-29380339 CCATTTTGGAACCAGAAGCCTGG + Intergenic
904298265 1:29537920-29537942 CCATCTTGCAAACAGCCACCTGG - Intergenic
904988918 1:34575845-34575867 CCAACTCGGAAGCAGATACTGGG + Intergenic
905000459 1:34664104-34664126 CCATCTTAGAAGCAGAGACCAGG + Intergenic
905020370 1:34806815-34806837 TCATCTTGGAAGCAGAGACTAGG - Intronic
905020772 1:34809787-34809809 CCATCTTGAAAGCAGAGACAGGG - Intronic
906745655 1:48220665-48220687 CCGTCTTGGAGGCATAGACTGGG - Intergenic
906785916 1:48615892-48615914 CCATCATGGAAGCAAATGCCAGG - Intronic
907446625 1:54512278-54512300 CCGTCTTTAAAGCAGAGAGCTGG - Intergenic
907761394 1:57364389-57364411 CCATACTGGAACAAGAGACCTGG + Intronic
908171177 1:61506127-61506149 CCATATTGAAAGCAGAGTCCAGG + Intergenic
908499479 1:64728943-64728965 CCATCTTAGAAGCAGAGAGCAGG + Intergenic
908669222 1:66527519-66527541 CCATCTTGGAAGCAGAGACTAGG + Intergenic
908965033 1:69750670-69750692 TCATCTTGGAAGGGGAGACTGGG - Intronic
909268391 1:73591758-73591780 CCAACTTGGAAGCAGAGACCAGG + Intergenic
909352021 1:74665227-74665249 CCATCTGTGAACCAGAGAGCAGG + Intronic
909717296 1:78724840-78724862 TCATGTCGGAAGCAGAGAACAGG + Intergenic
909983944 1:82137307-82137329 CCATCTTTGAAGCAGAGAGCAGG - Intergenic
909987760 1:82183645-82183667 CCATCTTGGAAACTCAGACTGGG - Intergenic
910218831 1:84868746-84868768 CCCTTCTGGAAGCAGAGACCAGG + Intronic
911024560 1:93423262-93423284 CTATTTTGGAAGCAGAGATCTGG + Intergenic
911099926 1:94087531-94087553 CCATGTTGCAGGCAGGGACCAGG - Intronic
911164346 1:94711870-94711892 CCATTTTGGAAGCAGAGACTGGG - Intergenic
911178449 1:94840796-94840818 CCTGCATGGAAGCAGAGTCCTGG + Intronic
911317707 1:96375467-96375489 CCATCTTTGAAGCAGAGACTAGG + Intergenic
911844187 1:102728476-102728498 CCACCTTGGAAGTACAGACCAGG + Intergenic
912138100 1:106685728-106685750 CCATCTTGGAAGCAGAGACCAGG + Intergenic
912701214 1:111879641-111879663 CCTTCTTGGAGGCAGAAAACTGG - Intronic
913183122 1:116341999-116342021 CCATCTATAAAGCAGAGAGCAGG + Intergenic
913183927 1:116349561-116349583 CCAACTTGAAAGCAAAGACCAGG - Intergenic
913234668 1:116769386-116769408 CCAGCTTTGCAGCTGAGACCTGG - Intergenic
913492799 1:119397380-119397402 CCATCTTGGAAGGAGACTCTGGG - Intergenic
913503331 1:119492123-119492145 CCATCTTGGAAAGAGACACTGGG - Intergenic
915887682 1:159740766-159740788 CCATCTTGGAGGTAGAGACTGGG - Intergenic
916920941 1:169466375-169466397 TCAGCTTGAAGGCAGAGACCAGG - Intronic
917015221 1:170522917-170522939 CCATCTTGGAAGTGAACACCAGG + Intergenic
917286202 1:173423934-173423956 CCTCCTTGGAAGCAGAGACCAGG - Intergenic
918334209 1:183491851-183491873 CCATCTTGGAAGCAGAGACTGGG - Intronic
918425363 1:184404426-184404448 CCATCTTGGAAGCCAAGACTGGG - Intronic
918790885 1:188826491-188826513 TCATCTTCGAAGTGGAGACCAGG + Intergenic
919001025 1:191831704-191831726 TCATCTTGGAAGGAGAGACTGGG - Intergenic
919159113 1:193805715-193805737 CCATCTTGGAAGCAGAGATTGGG - Intergenic
919349699 1:196433120-196433142 CCATCTTGAAAGCAGAGAGAAGG + Intronic
919536935 1:198798641-198798663 CATTCTTGAAAGCAGAGACCAGG + Intergenic
919628103 1:199932253-199932275 CCTTCTTGGAAGCAGAGAGATGG + Intergenic
919703059 1:200651473-200651495 CCATCTTTGAAGTAGAGAGCAGG + Intronic
920000047 1:202790821-202790843 CCATCTTGAAAGTGGAGACCAGG + Intronic
920265896 1:204722457-204722479 TCATCTTGGAAGCAGAGAGCGGG - Intergenic
920954786 1:210608798-210608820 CCATCTTGGAGGGAGAGACTGGG - Intronic
920987979 1:210908499-210908521 CCGTCTTGCAAGCAGAGAGGCGG - Intronic
922027402 1:221763646-221763668 CCATCTTGGAAGGAGAGACTGGG - Intergenic
922029045 1:221780505-221780527 CCACCTTGGAAGCAGATCCCAGG + Intergenic
922108951 1:222539015-222539037 CCATCTATGAGGCAGTGACCTGG + Intronic
922366171 1:224866022-224866044 TCATCTTGGAAGCATAGACTGGG - Intergenic
922441090 1:225655246-225655268 CCATATTGCAAGTAGAGACAGGG + Intergenic
922842877 1:228658474-228658496 ACATCTTGGAAGCAGAGACGGGG + Intergenic
922917764 1:229271995-229272017 GCACCTTGGAAGCAAAGCCCTGG + Intronic
923156142 1:231281131-231281153 CCACTTTAGAAGCAAAGACCAGG - Intergenic
923967138 1:239154549-239154571 ACAACTTGGAAGCAGAGCCCAGG + Intergenic
924550423 1:245070985-245071007 CCATCTTGGAAGCAGAGACCAGG + Intronic
1063171574 10:3514521-3514543 CAATCTGGGAAGCACAGATCAGG - Intergenic
1064216182 10:13402543-13402565 TCAGCTTTGAAGCAGAGATCTGG + Intergenic
1065060383 10:21894903-21894925 CCATCTTGGAAACAGAGACCAGG + Intronic
1065074198 10:22060656-22060678 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1065228833 10:23575621-23575643 CCACCTTGGGAGCAGAGATCAGG + Intergenic
1065259077 10:23906004-23906026 CCATTGTGGAATCAGAGACAGGG - Intronic
1065319235 10:24493830-24493852 CAATCTTGGTAGCAGAGACAGGG + Intronic
1065605765 10:27415886-27415908 CCAACTTGGAAGCAAAGGCTGGG + Intergenic
1065772170 10:29087636-29087658 CCATTTTGGAAGCAGGGAACAGG + Intergenic
1066578216 10:36849957-36849979 TCATCTTAGAAGTAGAGACCTGG + Intergenic
1066694062 10:38062186-38062208 CTGCCTTGGAAGCTGAGACCTGG + Intronic
1066733105 10:38451067-38451089 CCATGTGGGAGGCAGAGGCCGGG + Intergenic
1067838554 10:49657199-49657221 CCATCTTGGAAGCACAGAGCAGG - Intronic
1068062668 10:52088627-52088649 CCATCTTGGAAGCAGATGCTGGG + Intronic
1068265635 10:54644938-54644960 CCATCTTTGAAACAGAGGCCAGG + Intronic
1068423421 10:56823935-56823957 CCACCTTGGCAGCAGAGCACAGG + Intergenic
1068437765 10:57014691-57014713 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1068636350 10:59352291-59352313 CCATCTTCAAAGCGGAGAGCGGG - Exonic
1068766783 10:60773350-60773372 CCATCTTGGAAACAGAGAGCAGG - Intergenic
1069096649 10:64267409-64267431 CCATTTGTGAATCAGAGACCAGG + Intergenic
1069375217 10:67786573-67786595 CCATCTTGGAAGCAGAGACTGGG - Intergenic
1069938423 10:71936297-71936319 CCATCTTGAAAGCATACACCGGG - Intergenic
1070653784 10:78256825-78256847 CCATCCTGGAAGCAAAGCCCCGG - Intergenic
1071279812 10:84090749-84090771 CCATCTTTGAGGCAGAGATCTGG - Intergenic
1071704943 10:87987866-87987888 ACATCTTGGAAGCAGAGACCAGG - Intergenic
1071836464 10:89423064-89423086 ACATCTTGGAAGCAGAGACCAGG - Intergenic
1072483683 10:95833769-95833791 TCATCTTGGAAGCAGAGACCAGG - Intronic
1072753107 10:97998336-97998358 CAATTTGGGAAGCACAGACCAGG + Intronic
1073629508 10:105134481-105134503 TTATCTTGGAAGCAGACACCGGG - Intronic
1074673908 10:115826716-115826738 CCATCTGTGAAGCTGAGTCCGGG + Intronic
1074765356 10:116696099-116696121 CCATCTTAGAAGCAGAGACTGGG + Intronic
1076769541 10:132655568-132655590 CCCTCTTGGAAGCGGAGTTCAGG - Intronic
1077194856 11:1274227-1274249 CAATCTGGGAAGCAAAGGCCAGG + Intergenic
1077400092 11:2351054-2351076 CCATCTTGGACGCAGAGATAGGG - Intergenic
1077548890 11:3190669-3190691 CCATTTTGGAAGCAAAGATGGGG - Intergenic
1077683451 11:4268779-4268801 GCATCTTGGAAGAACAGACTAGG - Intergenic
1077686589 11:4297982-4298004 GCATCTTGGAAGAACAGACTAGG + Intergenic
1077691742 11:4349172-4349194 GCATCTTGGAAGAACAGACTAGG + Intergenic
1077719508 11:4613568-4613590 CCATCTTGGAAGCAGGTACCAGG - Intergenic
1077747587 11:4924347-4924369 CAATCTTGGACTCAGAAACCTGG + Intronic
1077844478 11:6010541-6010563 TCATCTTAAAAGCAGAGACCAGG + Intergenic
1077894641 11:6444530-6444552 CCATCATAGAAGCAGAGACCAGG + Intergenic
1078066622 11:8082995-8083017 CCATCATGGAACCAGGGACTGGG + Intronic
1078964761 11:16325940-16325962 TCGTCTTGGAAGCAGAGACTGGG + Intronic
1079385888 11:19979328-19979350 CCATCTTACAGGCAGAGGCCTGG + Intronic
1079676873 11:23239475-23239497 CCATCTTGGAAACAGAGATTAGG - Intergenic
1080368460 11:31607395-31607417 CCATCTTGGAAGCAGAGTGCTGG - Intronic
1080498735 11:32848143-32848165 CCATCTTGGAAGCAGAGACTGGG - Intronic
1080593034 11:33740082-33740104 CCATCTTTGAAGCAGAGAGTGGG + Intergenic
1080881971 11:36329899-36329921 CCGTCTTGGAAAAATAGACCTGG - Intronic
1081609854 11:44554858-44554880 CCATCTTGGAAGCAAAGAGTGGG + Intergenic
1081848263 11:46256790-46256812 CCATCTTGGAAGCAGAGAGCAGG + Intergenic
1083501800 11:63115689-63115711 CCATCTTGGAATGGAAGACCCGG + Intronic
1084194726 11:67517966-67517988 CCATCTTGGAAGCAGAGACCTGG + Intergenic
1084304426 11:68272200-68272222 ACAGCTGGGCAGCAGAGACCCGG - Intergenic
1084651327 11:70491054-70491076 CCACCTTGGAAGCAGAGTCCTGG + Intronic
1085570074 11:77551433-77551455 TCATATTGGGAGCAGAGACTAGG - Intronic
1085571238 11:77559666-77559688 GCATCTAGCAAGCAGAGGCCAGG - Intronic
1085839752 11:79998097-79998119 CCATTTTGAAAGCAGAGACTAGG - Intergenic
1086060845 11:82698501-82698523 ACATCTTGGAAGCAGAGACCAGG + Intergenic
1086074316 11:82834119-82834141 CCATCTTGAAAGCAGAGACTGGG + Intronic
1086497847 11:87422432-87422454 CAATCTTGGCAGCAGAGAATGGG - Intergenic
1086553634 11:88083785-88083807 CTATCTTGGAAGCAGAGAACAGG + Intergenic
1086738127 11:90332587-90332609 CCAGCTTGGAAAGAGAGACTTGG + Intergenic
1088117412 11:106328185-106328207 CAATCTTGGAAGTTGAGACAGGG - Intergenic
1088375238 11:109133580-109133602 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1088416439 11:109594538-109594560 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1088495485 11:110427763-110427785 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1088506321 11:110531231-110531253 CCAGCTGGGAAGCAGAGACTAGG + Intergenic
1088749012 11:112828130-112828152 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1088758381 11:112906386-112906408 CCATCTAGGAAGCAAAGAAGAGG + Intergenic
1089143840 11:116309910-116309932 TCATCTTGGAAGCAGAGAGGTGG + Intergenic
1089642193 11:119855037-119855059 CCCTCTTGGAAGCAGAGGTAGGG + Intergenic
1089829259 11:121310800-121310822 CCATCTTGAAAGCAGCAACTGGG + Intergenic
1089829571 11:121314913-121314935 CCATCTTGGAAGTAGGTACTGGG + Intergenic
1089878383 11:121747801-121747823 CCATCTTGAAAGCAGAGACTGGG + Intergenic
1090374469 11:126279247-126279269 CCATCTTCGAAGCAGAAAGCAGG - Intergenic
1090923734 11:131231384-131231406 CCAACGTGGAAGCTGAGACATGG + Intergenic
1090986679 11:131773164-131773186 CCACCTTGGAAGCAGAGACCAGG - Intronic
1092577623 12:9805283-9805305 TCATCTTGGAAGCAGAGACCAGG - Intergenic
1092765763 12:11851194-11851216 CCATTTTGGAAGGGGAGGCCAGG - Intronic
1092936534 12:13369071-13369093 CCATCTTGGAAACAGAGATCAGG - Intergenic
1093099291 12:15008027-15008049 CCATAGTAGAAGCAGAGACTTGG - Intergenic
1093295274 12:17382043-17382065 CCATCGTGGAAGCGGAGACTTGG + Intergenic
1093376483 12:18434112-18434134 CAATCTCGGAAGCAGAGACTGGG - Intronic
1093480677 12:19601260-19601282 CCATATTGGAATGAGAAACCTGG + Intronic
1093910526 12:24742362-24742384 CAATCTTGGCTTCAGAGACCCGG + Intergenic
1094256714 12:28438388-28438410 CCATCTTTGAAGCAGAGAACAGG + Intronic
1094468686 12:30781943-30781965 CCCCCTTGGAAGCAGACACTTGG - Intergenic
1094554650 12:31486307-31486329 CCATCTTAGAAGCAGAGACTAGG + Intronic
1095039454 12:37425326-37425348 CCATCTTGGATGCAAAGGCCAGG - Intergenic
1096310453 12:50516064-50516086 CCATCTTTGAAGTAGACAGCAGG - Intronic
1096335197 12:50749938-50749960 CCATTTTGGAAGTAGAGACCAGG + Intergenic
1096496269 12:52041029-52041051 CCACCCTGGAAGGAGAGGCCAGG + Intronic
1097399509 12:59112174-59112196 CCATCTTAGAAGCAGAAAGCAGG + Intergenic
1097441654 12:59615137-59615159 CTATCCTGGAAGGAGAGACAGGG + Intronic
1097955377 12:65480211-65480233 CCATCTTGGAAGCAACGATTGGG - Intronic
1098190888 12:67947066-67947088 CCATCTTAGAAGCAGAGACTAGG + Intergenic
1098507551 12:71271686-71271708 CCAACTTAGAAACAGAGACTGGG - Intronic
1098910652 12:76205119-76205141 CCATCTTGGAAACAGAAACTGGG + Intergenic
1098914780 12:76246003-76246025 CCATTCTGGAAGCATAGACAGGG - Intergenic
1099084255 12:78225503-78225525 CCATCTTGAAAGCAGAGACCAGG + Intergenic
1099161432 12:79246554-79246576 CCATCTTAGAAGCAAGGACCAGG - Intronic
1099432500 12:82604614-82604636 CCATCTTGGAAGCAGAGACCTGG + Intergenic
1099705880 12:86152324-86152346 CCATCTTGGAAGCAGAGGTCAGG - Intronic
1100004761 12:89881454-89881476 CCATTTTGGAAGCAGAGACCAGG + Intergenic
1100095331 12:91027069-91027091 CCATCTTGGAAACAAAGACAAGG - Intergenic
1100335383 12:93624191-93624213 CCATCTTGAAAGCAAAGACTAGG + Intergenic
1100369126 12:93949575-93949597 CCATCTTGGAAGAAAAGATTGGG - Intergenic
1100794930 12:98171835-98171857 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1101159838 12:101962310-101962332 CCATCCTGGAAGCAGAGACTGGG - Intronic
1101373432 12:104150979-104151001 CCTTTTTGGCACCAGAGACCAGG - Intergenic
1101570531 12:105949271-105949293 CCATCTTGAAAGCACAGACTGGG + Intergenic
1103846376 12:123904427-123904449 ACATCGTGAAAGCAGAGACTAGG + Intronic
1104123313 12:125819869-125819891 CCATCTTAGAAGCAGAGACTGGG - Intergenic
1104563431 12:129859152-129859174 CCATCTCCGAACCAGAAACCAGG + Intronic
1104872767 12:132012368-132012390 CCATCTGGGAAGCGGAAACCAGG - Intronic
1105042516 12:132971372-132971394 CCGTCTTGGAGGCAGACACTGGG + Intergenic
1105065454 12:133193486-133193508 TCATCTTGGAAGCACAGAGCAGG - Exonic
1105718996 13:23095329-23095351 CCATCTTGGGAGCAGAAACCAGG + Intergenic
1105822217 13:24089865-24089887 TCATCTTGGAAGTGGAGACTGGG - Intronic
1105968076 13:25402921-25402943 CCATCTTTGAAGCAGACACAGGG - Intronic
1106856398 13:33858114-33858136 CCATCTCGGAAGCTGAGATGTGG + Intronic
1106884504 13:34169444-34169466 CCATCTTGGAAGCAGAGGCTGGG + Intergenic
1107645597 13:42491584-42491606 CCACCTTAGAAGCAGGGACCAGG - Intergenic
1109279743 13:60342156-60342178 CCACCTTGGAAGCAGAGATCGGG + Intergenic
1110006119 13:70272504-70272526 TCATCTTGGAAGCAGAGACCTGG - Intergenic
1110161794 13:72387502-72387524 CCCTCTTGGAAACAGGGCCCTGG + Intergenic
1110521500 13:76484350-76484372 CCATCTTAGCAGCAGAGACCAGG - Intergenic
1110556945 13:76870440-76870462 GCATCTAGTGAGCAGAGACCAGG - Intergenic
1111312696 13:86510221-86510243 CCATCTTGGAAGTGGATACTGGG - Intergenic
1111553468 13:89848417-89848439 CCATATTCGAAGCAGAGACTGGG - Intergenic
1111554938 13:89868167-89868189 CTACCGTGGAAACAGAGACCAGG + Intergenic
1111809416 13:93080222-93080244 CCATCTTAGAAGTAGAGAGTGGG - Intergenic
1111874699 13:93878724-93878746 TCATCTTGGAAGCAGAGACTGGG + Intronic
1112788444 13:102977512-102977534 CCATTTTGGGAGCAGAGAGTTGG + Intergenic
1113674569 13:112198518-112198540 CCATCTTGGAAGCAGAGGCTGGG - Intergenic
1113754164 13:112797987-112798009 CCATCTTGGAAGCAGAGATGGGG - Intronic
1113810080 13:113135440-113135462 CCGTCTTGGAAGCAGAGACCAGG - Intronic
1113869561 13:113550584-113550606 CCATCCCGGAAGCAGAGAGCAGG - Intronic
1114430991 14:22660438-22660460 CCATCTTGGAAGCAGAGACTGGG - Intergenic
1114530297 14:23391281-23391303 CCATCCTGGGAGCAGAGGCATGG - Intronic
1114584938 14:23802682-23802704 CCATCTTTGAAGCAGAGACCAGG - Intergenic
1114719644 14:24867251-24867273 CTATCTTGGAAGCACAGACTGGG + Intronic
1115879536 14:37899555-37899577 CCATCTGGTAAGCAGAGGCTGGG - Intronic
1116095901 14:40367107-40367129 CCACCTTAGAAGCAAGGACCAGG - Intergenic
1116549358 14:46215980-46216002 CCATCTGGGAGCCAGAGATCCGG + Intergenic
1116748522 14:48851723-48851745 CCATCTTGGAAGCAGAAATCAGG + Intergenic
1116817737 14:49599239-49599261 TCTTCTTGGAAGCCGAGACGCGG + Intronic
1117437941 14:55735283-55735305 CCATCTTGGAAACAAACACCAGG - Intergenic
1117514406 14:56486291-56486313 CCATCTTGGAAACAGAGTTTGGG - Intergenic
1117949889 14:61072097-61072119 CCATCTTGGGAGTGGAGACAAGG - Intronic
1118380267 14:65212337-65212359 CCATCTTGGCAGCACAGAATGGG + Intergenic
1118996402 14:70840526-70840548 CCATCTTGGAACCAAAGACTGGG - Intergenic
1119080342 14:71686967-71686989 CCAGTTTGGAAGCAGAGAGCAGG + Intronic
1119178275 14:72585838-72585860 CAATATTGGAAGGAGAGAACAGG - Intergenic
1119547636 14:75484016-75484038 CCATCTTGGAAGCAGAGACAGGG - Intergenic
1119547644 14:75484064-75484086 CCATCTTGGAAGCAGAGACAGGG - Intergenic
1119915844 14:78401015-78401037 CCATCTTGGAAGCAGGGAACAGG - Intronic
1120169564 14:81235512-81235534 CTATCTTGGAAGCTGAGTCCAGG - Intergenic
1120402979 14:84055651-84055673 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1120609494 14:86622986-86623008 CCATCCTGGAAGCAGAGAGCAGG - Intergenic
1120691951 14:87602543-87602565 CCATATTGGCAGCAGACAGCAGG + Intergenic
1120721341 14:87892625-87892647 CCATCTTGGAGGCAGAGACCAGG - Intronic
1121851951 14:97229410-97229432 CCATTTTTGAAGCAGAGAGTGGG - Intergenic
1121954664 14:98203056-98203078 CCACCTTGGAAGTGGAGACCAGG - Intergenic
1122083329 14:99282364-99282386 CCATCTTGGCAGCAAAGGCTGGG - Intergenic
1122466911 14:101939949-101939971 CCATCTTGGAAGGTGGGGCCAGG + Intergenic
1122682371 14:103475532-103475554 TCATGTTGGAAGCAGAGAACAGG - Intronic
1122918503 14:104869758-104869780 CCATCCTTGAAGCAGAGACAGGG + Intronic
1123471502 15:20557550-20557572 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123494913 15:20815274-20815296 CCAGCCTGGAAAGAGAGACCTGG + Intergenic
1123646501 15:22442805-22442827 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1123731804 15:23152552-23152574 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123749941 15:23349934-23349956 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123997631 15:25729826-25729848 CCTGTTTGGAAGCAGAGACATGG - Intronic
1124022423 15:25936979-25937001 CCATCTTGGAAGCGGAGACCTGG + Intergenic
1124282309 15:28373830-28373852 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1124300392 15:28537785-28537807 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1125365126 15:38905373-38905395 CCATTTTGGAAGCAAAGTCTGGG - Intergenic
1125423629 15:39528806-39528828 CCACCTTGGAAGCAGAGACTGGG - Intergenic
1126369858 15:47934180-47934202 CCATCTTGGAAGCAGAAGACAGG - Intergenic
1127552126 15:60050808-60050830 CCATCTTGGAATTGGAGACCAGG + Intronic
1127722679 15:61718317-61718339 CCATCTTAGAAGCAGAGTGCGGG + Intergenic
1128220599 15:65965674-65965696 CCATTTTGGAAGCAGAGATTGGG + Intronic
1128300384 15:66563194-66563216 TCATCTTGGAAGCAGAGACTGGG + Intronic
1128761415 15:70218502-70218524 CCATCTTGGAAGCCTACACTTGG + Intergenic
1128912330 15:71527163-71527185 CCACCTTGAAAGTAGAGACGGGG + Intronic
1129114446 15:73357507-73357529 CCCTCCTGGAAGCTCAGACCTGG - Intronic
1129380272 15:75160667-75160689 CCATCTTGGAAGCAGAGAGCAGG - Intergenic
1129827571 15:78644473-78644495 CCATCTTGGAAGCAGATACCAGG + Intronic
1130785786 15:87094479-87094501 CCATCTTGAAAGCAGAAACCAGG + Intergenic
1131597402 15:93812530-93812552 CCCTCTTGAAATCAAAGACCAGG + Intergenic
1132248878 15:100318504-100318526 CCATCTGTGAAGCAGAGAGCAGG + Intronic
1132347653 15:101118251-101118273 CCATCTTAGAAGCAGAGACTGGG - Intergenic
1133517678 16:6525649-6525671 CCATCTAGGAAGTAGAGACGGGG - Intronic
1134437026 16:14269034-14269056 CCATCTTCCAAGCAGAGACCTGG - Intergenic
1134872022 16:17660772-17660794 ACATCTAGAAAGCAGACACCAGG + Intergenic
1135290937 16:21237513-21237535 CCATCTTGGAAGCGGAGACAGGG - Intronic
1136068309 16:27773306-27773328 CCCTCTAGGAACCAGAGCCCAGG + Intronic
1137314175 16:47299406-47299428 CCACCTTGGAAGCAAAGTACAGG - Intronic
1137406703 16:48194750-48194772 CCATCTTGGAAGTAGATACTGGG + Intronic
1138007495 16:53351524-53351546 CCATCTTGGAAGCAAAGACCAGG - Intergenic
1138349781 16:56340317-56340339 CCGAGTTGGAAGCAGACACCAGG - Intronic
1138695721 16:58811425-58811447 CCATCTTGGGAGTGGAGACTGGG - Intergenic
1139285591 16:65810776-65810798 CCATCTTGGAAGCAGAGTCCTGG - Intergenic
1139320492 16:66110002-66110024 TCATCTTGGAAGCAGAGACCAGG + Intergenic
1140241858 16:73209424-73209446 ACATCTTGTAAGCAGTGACCAGG - Intergenic
1140379852 16:74476738-74476760 CCATCTAGGAAGCAGAGGGAAGG - Intronic
1140463523 16:75160740-75160762 CCATCCTGGAAGAAGAGACCAGG - Intronic
1141921467 16:87138486-87138508 CCACCGTGGAAGCAGGGTCCAGG - Intronic
1142633923 17:1244898-1244920 CTGTCTTGGAAGCAGAGATCAGG - Intergenic
1144064732 17:11614694-11614716 CCATCTTGGAAGCAGAGGCCAGG - Intronic
1145378417 17:22373111-22373133 CCATCTTGGATGTAGAGACCAGG + Intergenic
1146098115 17:29952098-29952120 CCATCTAGGAAGCAGAGACAAGG - Intronic
1147811162 17:43170840-43170862 CTATCTTGAGAGCAGAGACTAGG + Exonic
1149006869 17:51815181-51815203 GCATCTAGTAAGCAGAGGCCAGG + Intronic
1149062088 17:52434479-52434501 CCATCTTTAAAGCAGAGAGCAGG + Intergenic
1149368171 17:55966264-55966286 CCATCTTGGAAGAAGCTACAGGG + Intergenic
1149561503 17:57610978-57611000 GCACCTTGAAAACAGAGACCTGG + Intronic
1150473125 17:65454242-65454264 CCATCTTAGAAACAGAGACTAGG + Intergenic
1151745185 17:76008123-76008145 CCATCCTGGAACCCGAGACGGGG - Exonic
1152156595 17:78637739-78637761 CCACCTTGGAAGCAGAGGCCAGG + Intergenic
1153166812 18:2270992-2271014 ACATCTTAGAAGCACAGACCAGG + Intergenic
1153273013 18:3341889-3341911 CCATCTATGAAGCAGAGAGCAGG - Intergenic
1153431994 18:5027889-5027911 CCATCTTGAAAGCAGAGACCAGG + Intergenic
1153583040 18:6594626-6594648 CCATCTTGAAAGCAGAGAGCAGG - Intergenic
1153833363 18:8942911-8942933 CCATGTTGCCAGCAGAGGCCTGG + Intergenic
1153844259 18:9034128-9034150 CCATCTTGGAGGCAGACAGCAGG + Intergenic
1155256175 18:24000009-24000031 CCAACTAGGCAGCAGAAACCGGG + Intronic
1155921548 18:31608253-31608275 CCATCTTGGAAGCAGACACTGGG + Intergenic
1156709063 18:39919752-39919774 CCATCTTGGACACATAGTCCTGG + Intergenic
1157786038 18:50483435-50483457 CCATCTTAGAAGCAGAGACCAGG + Intergenic
1159314704 18:66757127-66757149 GCATCCTGGAAGCAGAGACCTGG + Intergenic
1159332308 18:67012917-67012939 CCATCTTGGAAGTAGAGAGCTGG - Intergenic
1159356714 18:67345709-67345731 CCATTTTGGCACCAGGGACCAGG - Intergenic
1159687187 18:71437144-71437166 GCACCTTGGAAGCAGAGAAGAGG + Intergenic
1159809837 18:73004543-73004565 CCATCTTGTGAATAGAGACCAGG - Intergenic
1160437911 18:78865940-78865962 CCAGCGTGGAGGCAGAGGCCGGG + Intergenic
1160669270 19:349284-349306 CCATTTTGGGAGCAGAGACCAGG - Intergenic
1161044314 19:2126967-2126989 CCACCTTGACAGCAGAGGCCTGG + Intronic
1161939137 19:7391762-7391784 GCATCTAGGAGGTAGAGACCAGG + Intronic
1163115137 19:15184764-15184786 CCTTCTTGGAAGGACAGAGCTGG - Intronic
1163642372 19:18469028-18469050 CCATCCTAGAAGCAGGGGCCAGG + Intronic
1164613827 19:29652822-29652844 CCATCTTGGAAGCACAGACTGGG - Intergenic
1164672581 19:30081243-30081265 CCATCCTGGAAGCAGAGACTTGG - Intergenic
1164781973 19:30900066-30900088 CCATCTTTGAATCAGAAAGCAGG + Intergenic
1164844058 19:31416801-31416823 CCCTCTTGGTAGCAGAGGCTGGG - Intergenic
1165151157 19:33761075-33761097 CCACGTGGGAAGCAGAGACAGGG + Intronic
1165600093 19:37047406-37047428 TTATCTTAGATGCAGAGACCAGG + Intronic
1165780979 19:38434169-38434191 CCATCTTGGAAGCAGGCACTTGG + Intronic
1167384032 19:49153689-49153711 CCATCATGGCAGCCGGGACCAGG - Exonic
1167474606 19:49692430-49692452 ACATCCCGGAAGCAGAAACCTGG - Intronic
1167488976 19:49781077-49781099 GCATGGAGGAAGCAGAGACCTGG + Intronic
1167510952 19:49895154-49895176 CCATCCTGGAGGCAGATAACAGG - Exonic
1167754667 19:51404697-51404719 ACATCTTGGAAGCAGAGATCAGG - Intergenic
1167818126 19:51902101-51902123 CCATATTGAAAGCAGAAATCAGG + Intronic
1168249009 19:55130455-55130477 CCATCTGTGAAGCAGAGAGCAGG - Intergenic
1168524567 19:57078685-57078707 CCACCTTGGTAGCAGACCCCAGG + Intergenic
925066445 2:932080-932102 CCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066546 2:932386-932408 CCATTGTGGAGGCAGAGGCCTGG + Intergenic
925198643 2:1948391-1948413 CCACCATGGAAGTAGATACCAGG - Intronic
925312330 2:2894105-2894127 TCGTCTTGGACGCAGAGACTCGG - Intergenic
925622792 2:5810177-5810199 CCATCTTGTCGGCAGAGAACAGG - Intergenic
926659482 2:15447917-15447939 CTATCTTGGAAATAGAGACTGGG - Intronic
926687392 2:15708825-15708847 CCGTCTTGGGAGCAGAGGCAGGG - Intronic
926866396 2:17363687-17363709 TCATCTTGGATGCAGAGATGTGG + Intergenic
928448163 2:31351390-31351412 ACATGTTGGAAGCAGAGCTCAGG - Intronic
929139554 2:38655023-38655045 CCATCTTAGAAGGAGAGACCTGG - Intergenic
929812127 2:45199575-45199597 CCATCTTGGAAGTGGAAACCAGG + Intergenic
929992569 2:46802309-46802331 CCTGCTTGGAGGCAGAGGCCAGG + Intergenic
930239646 2:48922836-48922858 TCATCTTAGAAGCAAAGACTGGG - Intergenic
930511494 2:52350801-52350823 CCACCTTGGAAGCAGAGATAAGG + Intergenic
930511811 2:52355363-52355385 CCAGCTTAGAGGAAGAGACCTGG + Intergenic
930683862 2:54287180-54287202 CCACCTTGGAAGAAGAGATCAGG - Intronic
931115384 2:59161239-59161261 CCATTTTGTAAGCAGAGAGATGG - Intergenic
931409831 2:62018900-62018922 CCCTCTTGGCAGCAGAGACCAGG - Intronic
932272457 2:70422835-70422857 CCATCTTAGAAGCAGAGACCAGG - Intergenic
932368513 2:71168554-71168576 CCATCTTGGAAGCAGAGACCAGG + Intergenic
932484128 2:72071259-72071281 TCATCTTGGAAGCAGAGGCCAGG - Intergenic
932516785 2:72359414-72359436 CCATCTTGGAAGCAGTTTTCAGG + Intronic
932652298 2:73571429-73571451 CCATTTTGGAAGCAGAGACTGGG - Intronic
932689177 2:73897782-73897804 CCACCTTGGAAGCAGACTCTGGG - Intronic
932914637 2:75843480-75843502 CCATCTTGGAAGCAGAGACTGGG - Intergenic
933354405 2:81195523-81195545 CCAACTGGGAAGCAGAGACCAGG - Intergenic
933982392 2:87562377-87562399 CCATTTATGAAGCAGAGAGCAGG - Intergenic
934872404 2:97879079-97879101 CCACCCTGGAAGCAGAGAGAAGG + Intronic
935277036 2:101483986-101484008 CTATCTTGGAAGCAGAGACTGGG + Intergenic
935730744 2:106063255-106063277 CCATCTAGGAAGCAGGAAGCAGG + Intronic
936247995 2:110845188-110845210 CCATCTTGGAAGCAGAGACCAGG - Intronic
936311449 2:111388416-111388438 CCATTTATGAAGCAGAGAGCAGG + Intergenic
936391456 2:112078328-112078350 CCATCTTGGAAGCAGACACCAGG - Intronic
936870680 2:117131820-117131842 CCACATTGGGAGCAGAGACTAGG - Intergenic
937480800 2:122256810-122256832 CCATCTTGGATGGAGAGACCAGG + Intergenic
938461310 2:131499236-131499258 GCATCTAGGAAGTAGAGGCCAGG + Intergenic
938912883 2:135901534-135901556 CCATCTTCGAAGAAGGGACTGGG + Intergenic
940075959 2:149742733-149742755 CCGTCTTGGAAGCAGGGAATGGG - Intergenic
940372576 2:152919148-152919170 TCATCCAGGAAGCAGAGACTGGG + Intergenic
940478715 2:154200564-154200586 CCATCTTGAAAGTGGAGACCAGG - Intronic
941092775 2:161197622-161197644 CCATCTTGGAAACAGAGACTGGG - Intronic
941187185 2:162331612-162331634 CCATCTTGGAAGCAGAGGCTGGG + Intronic
941226100 2:162849884-162849906 CCATCTTGAAAACAGAGATTAGG + Intergenic
941693596 2:168527596-168527618 CCATCTTGGAAGCAGAGACTTGG - Intronic
941789343 2:169534347-169534369 CCATCTTGGAAGCAGAGGCTAGG + Intronic
942120430 2:172771211-172771233 CCACCTATGAATCAGAGACCAGG - Intronic
942336483 2:174892428-174892450 CCATCTTGGAAGCACAGTCTGGG + Intronic
942386911 2:175452252-175452274 CTATCTTGGAAGCAGAAATTAGG + Intergenic
942664413 2:178301907-178301929 GCCTCTTGGAAGCAGAGAGACGG + Intronic
942757349 2:179357611-179357633 CGAACTAGGAAGTAGAGACCAGG + Intergenic
942875888 2:180797059-180797081 TCATCTTGAAAGGAGAGACCAGG + Intergenic
943657574 2:190525932-190525954 CCATCTTGAAAGCAGAGCATTGG + Intronic
943677428 2:190729724-190729746 CCCTCTTGGAAGCACAGACAAGG - Intergenic
944213594 2:197231640-197231662 CCATCTAGTAGGCAGAGGCCCGG + Intronic
944669274 2:201981752-201981774 GCTTCTGGGAAGAAGAGACCAGG - Intergenic
945081080 2:206086273-206086295 CCATCTTGGAGGCAGAGCAAAGG + Intronic
945512494 2:210719928-210719950 TTACTTTGGAAGCAGAGACCGGG - Intergenic
945765352 2:213969591-213969613 CCATCTTGGAAGCAGATACTAGG + Intronic
945883180 2:215347975-215347997 CCATCTGGGAAGCAGAGGGTAGG - Intronic
946015510 2:216600961-216600983 CCATCTTGGAAGCACAAACTTGG + Intergenic
946472840 2:219978714-219978736 CCATCTTGAAAGTTGAGACCAGG + Intergenic
946628470 2:221640993-221641015 CCATCTTGGAAGCAAAGACCAGG - Intergenic
946779433 2:223177853-223177875 CCAGCTTGGAAACAGTGGCCAGG + Intronic
946978282 2:225177573-225177595 CCATCTTGGAAGAGGACACCAGG - Intergenic
947402763 2:229744883-229744905 CCATCTTGGAAGCAGAAAGCTGG - Intergenic
948654860 2:239470278-239470300 CCATCTTGGGAGCAGAGACCGGG + Intergenic
948719312 2:239888417-239888439 CCAACCTGGAAGCACAGACTGGG + Intergenic
1169639841 20:7739540-7739562 ACATCTTTGAAACAGAGACTGGG - Intergenic
1169770178 20:9191409-9191431 CCCTCTTAGAAGCAGAGACCAGG + Intronic
1170023480 20:11863075-11863097 CCATCTTGGAAGAAGAGATTGGG + Intergenic
1170534007 20:17322659-17322681 CCATCTTGGAAGGAGAGACTGGG - Intronic
1171318277 20:24215198-24215220 CCATCTCAAAAGCAGAGCCCAGG + Intergenic
1171394792 20:24825049-24825071 TCATCTTGGAAGCAGACACTAGG - Intergenic
1171534050 20:25870548-25870570 CCATCTTGGATGCAGAGACCAGG - Intergenic
1171571221 20:26253420-26253442 CCATCTTGGATGCAAAGGCCAGG - Intergenic
1171793078 20:29546304-29546326 CCATCTTGGATGCAGAGACCAGG + Intergenic
1171855374 20:30338102-30338124 CTATCTTGGATGCAGAGACCAGG - Intergenic
1172510974 20:35500816-35500838 CCATCCTGGAAGAAGAGATTAGG + Intronic
1173291502 20:41719039-41719061 CTATCTTTGAAGCAGGGAGCAGG - Intergenic
1173428124 20:42960316-42960338 CCATCTTGGAAGCAGAGAACAGG - Intronic
1173641626 20:44606896-44606918 CCCTCTTGGAAGCAGAGAGCAGG + Intronic
1173741155 20:45403400-45403422 CCATCTAGGATGCAGAAACCTGG - Intronic
1174184114 20:48693483-48693505 CCATCTATGAAGCAGAAAGCAGG + Intronic
1174688508 20:52479163-52479185 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1174856750 20:54052707-54052729 CCATCTTGGAAGTAGAGAACAGG + Intronic
1174992936 20:55533751-55533773 CCATCATGGAAGGAGGGCCCTGG - Intergenic
1175237173 20:57522789-57522811 CAAACTAGGCAGCAGAGACCAGG + Intronic
1175359396 20:58396382-58396404 CCATCTGGGAAGTGGAGACTAGG + Intronic
1175477800 20:59289083-59289105 CCACCTTGGGAGCAGAGGCTGGG - Intergenic
1175691201 20:61067183-61067205 CCACCCTGGCAGCTGAGACCCGG + Intergenic
1176158464 20:63635851-63635873 CCATCGTGGAAGCAGAGACCAGG - Intergenic
1176691737 21:9919409-9919431 CCATTTTAGAAGCAGAAACTGGG + Intergenic
1177000740 21:15609170-15609192 TCATTTTGGGAGCAGAAACCAGG + Intergenic
1177208948 21:18045878-18045900 CCATCTGAGAAGCAGAGAGAAGG + Intronic
1177921725 21:27161081-27161103 CCATATTGGAAGCAGAAAGTGGG + Intergenic
1178722735 21:35024306-35024328 CCATCAGGGTAGCAGAAACCTGG + Intronic
1178839066 21:36124077-36124099 TCATCTTGGAAGCACAGACCAGG + Intergenic
1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG + Intergenic
1178952693 21:36998256-36998278 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1179400623 21:41079897-41079919 CCATCTTGGAGGCAGAGACAGGG - Intergenic
1179828681 21:43982660-43982682 CCCTCTTGGAAGCGGAGTTCTGG - Exonic
1180046831 21:45310437-45310459 GCACCTAGGAAGCAGAGGCCGGG - Intergenic
1180146236 21:45920772-45920794 CCATATTGAAAGCAGAGACTTGG + Intronic
1180573396 22:16750440-16750462 CCATCTTGGATGCAGAGGTCAGG - Intergenic
1180660929 22:17466547-17466569 CCATCTTGGGGACAGATACCAGG - Intronic
1180736786 22:18023619-18023641 CCCTCCTGGAAGCAGAGGGCGGG - Intronic
1180842202 22:18964695-18964717 CCATGGTGGGAGCAGAGCCCGGG - Intergenic
1181450991 22:23020557-23020579 CCATCATGGAAGCAGAGATTGGG + Intergenic
1182788150 22:32925207-32925229 TGATGTTGGAAGCAGAGACTGGG - Intronic
1184328929 22:43813264-43813286 CCATCTTTGCAGCACACACCAGG - Intergenic
949303282 3:2609345-2609367 CCACCTTGGAAGCAGTGAGTGGG + Intronic
949494298 3:4617351-4617373 CCATCTTGAGAGCAGAGACCAGG - Intronic
949578693 3:5364428-5364450 CCATCTTGGAAACAGAGAATGGG + Intergenic
950570414 3:13796289-13796311 CAATCCTGGGAGCAGAGGCCTGG - Intergenic
951066770 3:18276066-18276088 CCATCTTTGAACCAGAAAGCAGG + Intronic
951241250 3:20288231-20288253 CCATGGTGGAAGGAGAGGCCTGG + Intergenic
951557331 3:23933867-23933889 CCATCTTGGAAGCAGAGACTGGG - Intronic
951870479 3:27356124-27356146 CCATCTTGGAAGCAGGGACTGGG + Intronic
951927978 3:27930668-27930690 GCATCTTGGAGGTAGAGACCAGG - Intergenic
952154778 3:30630840-30630862 CCATCTTGGAAGCAGGAAAGGGG + Intronic
952615962 3:35274288-35274310 CCATCTTGGAAGCAGAGACTAGG + Intergenic
953145365 3:40270044-40270066 CCATCTTGGAAGCAGAGAGTGGG - Intergenic
953747789 3:45588200-45588222 CCATCTATGAACCAGAGAGCAGG + Intronic
953772130 3:45785841-45785863 CCATGTTGGTACCAGAGCCCAGG + Intronic
954161911 3:48728909-48728931 TCACATTGGGAGCAGAGACCAGG + Intronic
955609262 3:60739615-60739637 CCATCTTGTAGGTAGAGGCCAGG - Intronic
955752459 3:62196626-62196648 CCAGCATGGAAGTAGGGACCAGG + Intronic
955754295 3:62212578-62212600 CCATCTTGCAAACTGAAACCAGG + Intronic
956048872 3:65225780-65225802 CCAGTTTGGAAGCAGAACCCTGG - Intergenic
956085410 3:65603800-65603822 CCATCTTGGAAGGAGAGACCAGG - Intronic
956148442 3:66215962-66215984 CCATCTTGGAAGCAGGAACTGGG - Intronic
956735587 3:72235517-72235539 TCATCTATGAAGCAGAGACCAGG - Intergenic
956764613 3:72473868-72473890 CCATCTTGGAAGTGGAGATAGGG + Intergenic
956765506 3:72481181-72481203 CCATCTTAGAAGCAGAGACTGGG + Intergenic
956773548 3:72547027-72547049 CCATCTTGGAAGCAGAGGCCAGG + Intergenic
957253898 3:77812079-77812101 CAAACTTGGAAGCAGAGATTAGG - Intergenic
957817272 3:85317553-85317575 CTACCTTGGAAGCAGAGACTTGG - Intronic
957941309 3:87007850-87007872 CCATCTATGAACCAGAGAGCAGG + Intergenic
958002679 3:87771585-87771607 CCATCTTGGAAGCAGAGCACAGG - Intergenic
958832485 3:99106485-99106507 CCCTCTTGGAAGCAGTGAGTAGG - Intergenic
959154785 3:102653559-102653581 CCATTTTGGAAGTGAAGACCTGG + Intergenic
959356579 3:105337962-105337984 CTATCTTGGAAGCAGTGACTTGG + Intergenic
959594217 3:108111575-108111597 CCGTCTTGGAAACAGAGTCCAGG - Intergenic
959796035 3:110429383-110429405 CCCTCTTGGAAGAAGAGTCTAGG + Intergenic
960137581 3:114121491-114121513 CCATCTTAAAAGCCGAGACCAGG + Intergenic
960268539 3:115649183-115649205 CCATCTTGGAGACAGAGACCAGG - Intronic
960292862 3:115907420-115907442 CCATCTATGAAGCAGAGAGTGGG + Intronic
960977874 3:123194024-123194046 CCGTCTTGGAAGCAGAGATCAGG - Intronic
962445839 3:135463860-135463882 TCATCTTGGAAGCAGAGAGCAGG + Intergenic
962742632 3:138373065-138373087 CCATCTTGGACGGTGAGACCTGG + Exonic
963469821 3:145726301-145726323 CCTTCTCGGAAAAAGAGACCAGG + Intergenic
963504021 3:146161866-146161888 CGATCTTGTAAGCACAGCCCCGG - Intronic
963533667 3:146501734-146501756 CCATCTTGGAAGTAGAGACCAGG - Intergenic
963713556 3:148776216-148776238 CCATCTTGGAAGCAGAGACCAGG + Intergenic
963840317 3:150098068-150098090 CCATCTTCGAAGTAAAGACTGGG + Intergenic
964434393 3:156636476-156636498 CCATCTTGGAAGCAGAGACCTGG - Intergenic
964593803 3:158398386-158398408 CCATCTTGGAAGCAGACACCTGG - Intronic
964663217 3:159143905-159143927 CCATCTTGGAAGCTGAGACCAGG - Intronic
965350396 3:167604832-167604854 CCATCTAGGAAGCAGAAAGTAGG + Intronic
965810126 3:172583118-172583140 CCATCTATGAACCAGAGAGCAGG - Intergenic
966476987 3:180360498-180360520 CCATCTTGCAAGCAGTGACCAGG + Intergenic
966752532 3:183335985-183336007 CCATCTTGGAAGGAGAGACTGGG + Intronic
968044952 3:195618772-195618794 CCATTCCAGAAGCAGAGACCAGG + Intergenic
968060736 3:195724824-195724846 CCATTCCAGAAGCAGAGACCAGG + Exonic
968504726 4:966571-966593 CCACCTTGGAAGCAGCTGCCCGG + Intronic
968630118 4:1646023-1646045 CCATCTTGGAAGCAGAGGGCAGG + Intronic
969278924 4:6156137-6156159 GTTTCTTGGGAGCAGAGACCGGG + Intronic
970207036 4:13665481-13665503 CCATCTATGAACCAGAGAACAGG - Intergenic
970464717 4:16310968-16310990 CCATCTTGGAAGCAGATACTGGG + Intergenic
970568921 4:17360413-17360435 CCATATTGGAAGCACAGAGCAGG - Intergenic
970579108 4:17458073-17458095 CCATCTTGGAAACAAAGAGCAGG + Intergenic
970694980 4:18666661-18666683 CCATACTGGAAGCAAAGACCAGG - Intergenic
971090319 4:23335675-23335697 CCATCTTGGAGGCAGAGACCAGG + Intergenic
971991287 4:33898239-33898261 CCATCTTGGAAGTGAAGATCAGG + Intergenic
972371373 4:38426649-38426671 TCATCTTGGAAGCAAAGACCAGG + Intergenic
972732998 4:41813662-41813684 CCATCTTGGAAGTAGAGAGATGG - Intergenic
972987734 4:44785271-44785293 CCATCTTGGAAGAAGAGACCAGG - Intergenic
973854748 4:55000075-55000097 CCATCTTGGAAGAAGAGACGGGG + Intergenic
974096313 4:57368424-57368446 CCATCTATGAAGCAGAGAGTAGG - Intergenic
974525657 4:63047057-63047079 CGATCTTGGAAGTTGAGATCAGG - Intergenic
975274944 4:72485919-72485941 CTATCTTTGAAGCAGAGACTGGG + Intronic
975761380 4:77623786-77623808 CATTCTTTTAAGCAGAGACCTGG - Intergenic
976040160 4:80874579-80874601 CCATCTTGGAAGCAGAAAGGAGG - Intronic
976129212 4:81866984-81867006 CCATCTTGGAAGCAAGGACTGGG - Intronic
976872343 4:89810513-89810535 CCATCTTGGGAGTAGAGAACCGG + Intronic
976950306 4:90820412-90820434 CCATCTTGGAAGCAGAGAGATGG - Intronic
977149904 4:93498232-93498254 CCATCTTGGAAGCAGAAACCTGG - Intronic
977603771 4:98961508-98961530 CCCTATTGGAAGCAGAGACGAGG + Intergenic
977700957 4:100022285-100022307 CCATCTTGGAAGCAGGGAGCAGG - Intergenic
977775540 4:100915180-100915202 CCATTTTGGAAGCAGAGACTAGG + Intergenic
978826968 4:113036736-113036758 ACATCTTGCAAGCAGAGGCACGG + Intronic
978827878 4:113046589-113046611 CCATCTGGGAAGAAGAGACCTGG + Intronic
979288279 4:118951256-118951278 GCATCTTGGAAGCAGAGAAGGGG - Intronic
979526360 4:121721511-121721533 CCATCTTGGAAGCAGAGAGAAGG + Intergenic
979593384 4:122506016-122506038 ACACCTTGGAAGCAGAGACTGGG - Intergenic
979748141 4:124242782-124242804 CCATCTTGGAAGCAGAGACCAGG + Intergenic
980119377 4:128712076-128712098 CCATCTTAGAAGAAGAGATTGGG - Intergenic
980364317 4:131779615-131779637 CCATTTTAGAAGCAGAAACTGGG + Intergenic
980482104 4:133400376-133400398 CCATCCTTGAAGCAAAGAGCAGG - Intergenic
980731495 4:136830378-136830400 TCATTTTGGAAGCTGAGACTGGG - Intergenic
981407467 4:144387689-144387711 CCATTTTGGAAGCAGAGACCAGG - Intergenic
981613953 4:146626522-146626544 CTATCTTGGAAGCAGAGACTGGG + Intergenic
981709544 4:147695566-147695588 CCATCTTGGTAGCAGAGCCTGGG - Intergenic
981911845 4:149991093-149991115 CCATCTTGGAAGTAGAGACCAGG - Intergenic
982148196 4:152421625-152421647 GCATGTTGAAAGCAGAGACAGGG - Intronic
982524345 4:156458547-156458569 TCATCTTAGAAGTGGAGACCAGG + Intergenic
983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG + Intergenic
983451669 4:167919619-167919641 CCATCTGGGCAGCAGAAAGCAGG - Intergenic
983635100 4:169889844-169889866 CCATCTTGGATGCAGAAAACAGG + Intergenic
984203886 4:176762429-176762451 CCACCTTAGAAGCAGAGACGGGG + Intronic
984255367 4:177384101-177384123 CCATCTTGGTAGCGGAGATCAGG - Intergenic
984295470 4:177848789-177848811 GCTCCTTGGTAGCAGAGACCTGG + Intronic
984411606 4:179404724-179404746 CCACATTGGGAGCAGAGACTAGG - Intergenic
984900658 4:184583287-184583309 CCATCTTGGATGCAGAGACCAGG + Intergenic
985067734 4:186139519-186139541 CCATCTAGGAAGCATGGAGCCGG + Intronic
985231177 4:187819856-187819878 CCATCCTGGGAGCAAAGACAGGG + Intergenic
985231412 4:187821898-187821920 CCATCCTCGAAACAGAAACCAGG + Intergenic
985692829 5:1323153-1323175 CCACCTGGGCAGCAGAGGCCAGG + Intronic
986179793 5:5382936-5382958 CCATCTTGGAAGCAGAGACTGGG + Intergenic
986752053 5:10796063-10796085 CTATCTTGGAAGCAGAGAACAGG - Intergenic
987238160 5:15964680-15964702 CCATCTTGGAAGCAGTGAACAGG + Intergenic
987502432 5:18731201-18731223 ACATCTTAGAAGCAGAGATGGGG + Intergenic
987559247 5:19496908-19496930 TCATCTTGGAAGCAGAGCCCAGG + Intronic
987647570 5:20694167-20694189 CAATCTTGGAAGTGGAGACCAGG + Intergenic
987724172 5:21676166-21676188 CCAACTTGGAAACAGAGATCAGG - Intergenic
987953708 5:24710138-24710160 CCATCTTGGATATGGAGACCAGG + Intergenic
988363616 5:30267580-30267602 CCATCTTTGAAGCAGAGAGTGGG + Intergenic
988673305 5:33405503-33405525 CCATCTTGGAAGCAGAGAACAGG + Intergenic
988886686 5:35565314-35565336 CCATCTTGGAAGCAGGGGATGGG + Intergenic
989561979 5:42862951-42862973 CCATCTTGGAACCAGATCCCAGG - Intronic
990022366 5:51143245-51143267 CCATCTTGAAAGCAGAGACCAGG + Intergenic
990428024 5:55707948-55707970 CCATCTTGGAAGCAGAGACCGGG + Intronic
990625704 5:57608054-57608076 ACATCTTGGAGGCAGAGAGCAGG + Intergenic
990976008 5:61562559-61562581 ACCTCTTGGAAGCAGACACCCGG - Intergenic
991929040 5:71733566-71733588 CCATCTTGGAAGCAGAGACCAGG - Intergenic
992639834 5:78759753-78759775 ATGTCTTGGAAGCAGAGACTGGG - Intronic
993106210 5:83603972-83603994 TCATCTTGGAAATAGAAACCAGG - Intergenic
993108186 5:83623891-83623913 CCATTCTGGAAACAGAGACTGGG + Intergenic
993212506 5:84970800-84970822 CCATCTTGGAAGTACAGATCAGG + Intergenic
993304203 5:86254359-86254381 TCATCTTGGGAGCAGTGACCAGG + Intergenic
993478382 5:88392579-88392601 CCAGCATGGATGCAGAAACCAGG + Intergenic
993601001 5:89924821-89924843 TCATCTTGGAAGCAGAGACTGGG - Intergenic
994015972 5:94965911-94965933 ATATCTTTGAAGCAGAGACCAGG + Intronic
994269295 5:97758263-97758285 CCATCTGGGAGGCGGAGGCCAGG - Intergenic
994335601 5:98561878-98561900 CCATCTTGGAAGTGGAGACCAGG + Intergenic
994773761 5:104017509-104017531 CCATCTTGGAAGCAGAGACCAGG - Intergenic
994804186 5:104421901-104421923 CTATCTTGGAAGTAGGGAACAGG + Intergenic
995169658 5:109092056-109092078 CCAGCTTGGAATCAAAGATCAGG + Intronic
995335623 5:110995710-110995732 CCATCTTAGAAGCAGAGGCTAGG + Intergenic
996871996 5:128202172-128202194 CCATCTTGGAAGCAGAGATGGGG - Intergenic
997100947 5:130968869-130968891 CCATCTTAAAAGCAGAGACCAGG + Intergenic
997107412 5:131035990-131036012 CCATATTGGAAGCAGATAACAGG - Intergenic
997708477 5:135981644-135981666 CCATCTTGGGAGCAAAGACTGGG + Intergenic
997715142 5:136036931-136036953 TCACCTTGGAAGCAGACAACGGG + Intronic
997757650 5:136414896-136414918 CCTTCTTGTTAGCAGAGATCTGG + Intergenic
997989372 5:138531327-138531349 CCATCTTAAAAGCAGAGAGCAGG + Intronic
998458442 5:142291789-142291811 CCATCTTGGAGGCAAAGACCGGG - Intergenic
998806355 5:145920921-145920943 CCATCTATGAACCAGAGAGCAGG + Intergenic
998848448 5:146333188-146333210 CCATCCTGGAAGATGAGAACTGG - Intronic
998871224 5:146554531-146554553 CCAACTTGCAAGCAGAGACCAGG - Intergenic
998932322 5:147194879-147194901 CTATCTTGAAAGTAGAGACCAGG - Intergenic
998971315 5:147595459-147595481 CCATCTTGGAAGTAGACACCAGG + Intronic
999221466 5:149982321-149982343 CCATCTGGGGAGCAAAGACTGGG - Exonic
999734220 5:154500558-154500580 CCACCTTAGAAGCAGAGACCAGG - Intergenic
999865030 5:155691693-155691715 TTATCTTGGAAGCAAAGGCCAGG + Intergenic
999895439 5:156027873-156027895 GCATCTTGGAAGCAAAGACCAGG - Intronic
1000201101 5:159011976-159011998 GCATTTTCTAAGCAGAGACCAGG - Intronic
1000268241 5:159658406-159658428 CCATCTACGAAGCTGAGAGCTGG - Intergenic
1000834108 5:166134181-166134203 CCATCATGGCATCAGAGCCCAGG - Intergenic
1001443023 5:171760607-171760629 CTATCTATGAAGCAGAGAGCAGG - Intergenic
1001923760 5:175621109-175621131 CCATCTTAGAAGTGGAGACTGGG + Intergenic
1002077620 5:176718260-176718282 GCATGGTGGAAGCAAAGACCAGG - Intergenic
1002357639 5:178643655-178643677 CCATCTTGAAAGCAGAGACCAGG + Intergenic
1003058322 6:2842280-2842302 TCATCTTGGAAACAGAGAGCAGG - Intergenic
1003833456 6:10040784-10040806 CCATCTTGGAAGCAGAGAGCAGG - Intronic
1004019532 6:11764214-11764236 TAATTTTGGAAGCAGAGAGCTGG - Intronic
1005106808 6:22232626-22232648 CCATCTGGGCAGCAAAGATCTGG - Intergenic
1005214532 6:23509645-23509667 CCATCTTGGAAGCAGAGATGGGG + Intergenic
1005353519 6:24960307-24960329 CCATCTTGGAAGCAGAGACCAGG - Intronic
1005376794 6:25190847-25190869 CCAATTTGGAAGCAGAGATTGGG + Intergenic
1005443118 6:25893210-25893232 CTATCTTGGAAGCAGAGACCTGG - Intergenic
1005518261 6:26574954-26574976 CTATCTTGGAAGGAGAAAGCAGG + Intergenic
1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG + Intergenic
1006814821 6:36843027-36843049 CCATCTTGGAAGCAGAGACCTGG - Intergenic
1007492285 6:42232786-42232808 CCCTCTGGGAAGCAGAAGCCTGG - Exonic
1007948243 6:45845032-45845054 CCTTCTGTGAAGTAGAGACCAGG + Intergenic
1010026170 6:71219769-71219791 CCATCATGGAAGGAGAGATAGGG + Intergenic
1010134708 6:72537690-72537712 CAATCTTGGAAGGAGAGTCTGGG - Intergenic
1010367605 6:75069908-75069930 TCATCTTGGAAGCAGGGAACAGG + Intergenic
1010473484 6:76259033-76259055 CCATTTTGGAGGCAGAAACCAGG - Intergenic
1010654340 6:78494437-78494459 CCATCTTGGAAGCATAAACTGGG - Intergenic
1010891647 6:81319918-81319940 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1011014660 6:82741963-82741985 CCATCCTGGAAGCAGGGAAGGGG - Intergenic
1011038449 6:83002773-83002795 CCATCTTGGAAGCAGACATGGGG + Intronic
1011368556 6:86607505-86607527 CTATGTTGCAAGCAGAGAACAGG + Intergenic
1011855538 6:91685114-91685136 TCACCTTGCAAGCAGAGACCAGG - Intergenic
1012352379 6:98268562-98268584 CCATCTTGGGAGTGGAGACTGGG - Intergenic
1012874734 6:104712879-104712901 TCACCTTGGAAGCTGAGACCAGG + Intergenic
1013142576 6:107352804-107352826 CCATCTAGAAGGCAGAGGCCAGG + Intronic
1013785220 6:113772045-113772067 CCATCTAGTAAGTAGAGTCCAGG + Intergenic
1014053912 6:116990353-116990375 CCACCTTGGAAGCAGAGGGAAGG + Intergenic
1014486626 6:122007248-122007270 CCATCTTGGTGGAAAAGACCAGG + Intergenic
1014716078 6:124865752-124865774 CCATCTGGGAAGCAGACAGTGGG + Intergenic
1014771425 6:125462085-125462107 CCATCTTAGGAGTAGAGACCAGG - Intergenic
1015655942 6:135519265-135519287 CCATCTTGGAAATGAAGACCAGG - Intergenic
1015840985 6:137477021-137477043 CCATCCTGAAAGCAGAGACCAGG + Intergenic
1016806851 6:148220224-148220246 CCATTGAGGAAGCAGAGACGGGG - Intergenic
1017173016 6:151475691-151475713 CCATCTTGGAAGCTGAGACCAGG - Intergenic
1017832521 6:158143885-158143907 GCATCTTGGGAGTAGAGTCCAGG + Intronic
1018378898 6:163240130-163240152 CCGTCTCGGAAGCAGAGCTCTGG - Intronic
1019321225 7:416199-416221 TCAGCGTGGAGGCAGAGACCGGG + Intergenic
1020565752 7:9793509-9793531 CCATTTTGAAAGCAGAGAGATGG - Intergenic
1020590025 7:10124004-10124026 TCATCTTGGAAGCAGAGACCAGG - Intergenic
1020597300 7:10223771-10223793 CCACTTTGGAAGTGGAGACCAGG - Intergenic
1021539634 7:21742942-21742964 CCATTTTGGAAGCAGAGACCAGG - Intronic
1021695118 7:23268889-23268911 CCTTCTTAGATGGAGAGACCAGG - Intronic
1021943841 7:25705602-25705624 CCATCTTGGAAGCGGAGACAGGG + Intergenic
1022371089 7:29772337-29772359 CCAACTTGGGAGCAGAGACTAGG - Intergenic
1022477469 7:30721067-30721089 CCATCTTAGAAGCAGAGACTGGG - Intronic
1022640773 7:32180560-32180582 TCATCTTGGAAGCAGAAATCAGG + Intronic
1022841124 7:34164707-34164729 CCATCCTGGAGGCAGAGACTGGG + Intergenic
1023028177 7:36070792-36070814 ACATTTTGGGAGCAGAGACTGGG + Intergenic
1023848900 7:44139729-44139751 CCGTGGTGGAAGCAGAGAGCGGG - Intronic
1024265421 7:47602583-47602605 CCATTTTGGAAGAGCAGACCAGG + Intergenic
1024267576 7:47618648-47618670 CCATCTTTGAAGCAGAGAATGGG + Intergenic
1024556993 7:50612407-50612429 GCATCTAGCAGGCAGAGACCAGG + Intronic
1024939955 7:54751957-54751979 CCAGCTTGTAAGCAGAGGCCAGG + Intergenic
1025285521 7:57657479-57657501 CCATCTTGGATGCAGAGACCAGG - Intergenic
1026111778 7:67464186-67464208 CCATCTGTGAACCAGAAACCAGG - Intergenic
1026182508 7:68054312-68054334 CCATCTATGAAGCAGAGAGCAGG + Intergenic
1026226577 7:68447304-68447326 CCATCTGTGAAGAAGAGACTGGG - Intergenic
1026507343 7:70996225-70996247 CCATCCTGGTAGCAAAGACTGGG - Intergenic
1026965428 7:74436269-74436291 CCATCTTGGAAGCAGAGACTAGG - Intergenic
1026965729 7:74438727-74438749 CCATCTTAGAAGAAAAGACTGGG - Intergenic
1027719141 7:81716728-81716750 CCATCTGGGAATCAGATAACTGG + Intronic
1027859426 7:83556931-83556953 CCATCTCAGAAGCAAAGACTAGG + Intronic
1027989924 7:85345209-85345231 TCATCTTGAAAGCAGAGACTGGG - Intergenic
1028624085 7:92858060-92858082 CCAGCTTGGAAGCAGAGACTGGG + Intergenic
1028970563 7:96854039-96854061 CCATCTTGGAAGCAAACACTGGG - Intergenic
1028975441 7:96907940-96907962 CTATCTTGGAAGCAGACACAGGG + Intergenic
1029540434 7:101179527-101179549 CAACCTTGGAAACAGAGACGGGG + Intronic
1030408844 7:109148524-109148546 CTATCTTGCAAGCAGAGACCAGG - Intergenic
1030481515 7:110110623-110110645 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1030671675 7:112345119-112345141 CCATCTTGGAAATAGAGACTGGG - Intergenic
1030817172 7:114052544-114052566 CCATCTTGGAAGGAGAGACTGGG + Intronic
1030867896 7:114721823-114721845 CTATCTTGGAAGTAGAGACAGGG + Intergenic
1031164847 7:118215535-118215557 TCATCTTGAAAGCAGACACTGGG - Intronic
1031634863 7:124090455-124090477 TCATCTTGGAAGCAGAGACAGGG + Intergenic
1031838817 7:126712083-126712105 CCATGTTGAAAGCTGAGACAGGG - Intronic
1032445069 7:131975141-131975163 CCATCTTGGGAGCAGAGACTGGG + Intergenic
1032876846 7:136047045-136047067 CCATCTTGGAAGCAGAGACGAGG - Intergenic
1033686783 7:143647423-143647445 CCATCTTGGGAGCACAGAGCAGG + Intronic
1033688951 7:143719884-143719906 CCATCTTGGGAGCACAGAGCAGG - Exonic
1033697826 7:143810191-143810213 CCATCTTGGGAGCACAGAGCAGG - Intergenic
1033866090 7:145692055-145692077 CCATCTAGAAAGAAGAGAACAGG - Intergenic
1033919825 7:146376926-146376948 TCATCTTAGAACCAGAGACTGGG + Intronic
1034056878 7:148044621-148044643 CCATCTATGAAGCAGAGAGTCGG + Intronic
1034278733 7:149837252-149837274 CCCTCCTGGAAGCAGAGACCAGG - Intergenic
1034303096 7:150033228-150033250 CCAGCTAGCAAGCAGAGTCCTGG - Intergenic
1034555564 7:151848340-151848362 CCACCTTGGAAGCAGAGACCAGG + Intronic
1034802954 7:154064040-154064062 CCAGCTAGCAAGCAGAGTCCTGG + Intronic
1034954502 7:155326290-155326312 CCGTCCTGGAAGCAGAGATTGGG - Intergenic
1035725112 8:1819500-1819522 CTGTCTTGTGAGCAGAGACCAGG - Intergenic
1035825173 8:2637301-2637323 CCATCTATGAAGCAAAGACGAGG - Intergenic
1037024024 8:14009855-14009877 TCATCTTAGAAGCAGAGACAAGG + Intergenic
1037643922 8:20773108-20773130 CCTTCTGGGAAGCAGAAACCAGG + Intergenic
1038026692 8:23597166-23597188 CCATCTACGAACCAGAGAGCTGG - Intergenic
1038706477 8:29898614-29898636 CTATCCTGGAAACAGAGACAAGG - Intergenic
1038882083 8:31625927-31625949 CCATCTTTGGAGAAGAGAACAGG + Intergenic
1039083758 8:33759660-33759682 CCATCTGGGAAGCAAAGACTGGG - Intergenic
1039148111 8:34472386-34472408 CCATCTTGAAAGCAGACAGTAGG + Intergenic
1039883476 8:41641899-41641921 CCAACTTGGAAGCAGAGACCAGG - Intergenic
1040400374 8:47044154-47044176 CCACCTTGGCAGCAGAAAACTGG + Intergenic
1040806936 8:51405457-51405479 ACATCTTAGAGGCAGAGACAAGG + Intronic
1040818097 8:51529903-51529925 GCATCTTGTAAGTAGAGGCCAGG - Intronic
1040984563 8:53279667-53279689 CCATCTTAGAAGCAGAGAGATGG + Intergenic
1041367361 8:57122330-57122352 CCATCTTGGAAACCAAGCCCAGG - Intergenic
1042003227 8:64150212-64150234 CCACCTTGGAAGTAGAGCCTGGG + Intergenic
1042211873 8:66389395-66389417 CCAACTTGGAAGTGGAGACCAGG - Intergenic
1042387718 8:68197044-68197066 CTATCTTGGAAGCAGAAACCAGG - Intronic
1042831047 8:73029048-73029070 CCATCGTGGAAGCAGAACCAGGG + Intronic
1042851154 8:73217230-73217252 CCATCTTGGAAGCAAAGACCAGG + Intergenic
1043199866 8:77353334-77353356 CCATCTTGGAAGCAGAAACCAGG + Intergenic
1043538119 8:81228445-81228467 CGGTCTTGGAAGCAGAGACCAGG - Intergenic
1043716437 8:83492934-83492956 CCACCTTGGAAGCAGAGACTGGG - Intergenic
1043761132 8:84069720-84069742 CTTTCTTAAAAGCAGAGACCAGG - Intergenic
1043794161 8:84514489-84514511 CCATCTTGGAAGCAAAGAGTGGG - Intronic
1044423213 8:92022619-92022641 CCATCTTGAGAGCAGAGACCAGG + Intronic
1044730992 8:95228715-95228737 CCATCATGGGAGCTGAGATCAGG - Intergenic
1044794976 8:95887498-95887520 CCATCTTGGAAGCACAGACTGGG - Intergenic
1044928674 8:97231308-97231330 CCATGTTGGAAATGGAGACCAGG + Intergenic
1045054264 8:98355798-98355820 CCATCCAGAAAGCAGAGAGCTGG - Intergenic
1045142034 8:99296808-99296830 CCATCTTGGAAACAGAGACCAGG + Intronic
1045408374 8:101890653-101890675 CACTCTTGGAAGCAGAGACTAGG + Intronic
1046292568 8:112181873-112181895 CCATTTTGGAAGCAGTGACCTGG + Intergenic
1046418683 8:113949188-113949210 TCGTCTTAGAAGCAGAGACCAGG + Intergenic
1046623165 8:116549452-116549474 CTATCTTGGAAGCGGAGACCAGG + Intergenic
1047564729 8:126031553-126031575 ACATCTACTAAGCAGAGACCAGG - Intergenic
1047870304 8:129075039-129075061 CCATCTTAGAAGTGGAGACTGGG - Intergenic
1048049987 8:130807578-130807600 CCATCGTGGAAGCAGAAACAAGG + Intronic
1048234649 8:132677781-132677803 CCATCTTGGAAGTGGAGACCAGG - Intergenic
1048274941 8:133058996-133059018 CCATTTTGGAAGCAGTGAGAAGG + Intronic
1048347074 8:133584079-133584101 CCATCTATGAAGCAGAGAACAGG + Intergenic
1048363314 8:133716209-133716231 GCATCTAGGGAGCAGAGACTAGG + Intergenic
1048801228 8:138195795-138195817 CCATCTTATCAGCAGAAACCAGG + Intronic
1048838401 8:138543561-138543583 CCATCTTGGGAGCTGAGCACTGG - Intergenic
1049665926 8:143842569-143842591 CCATATTGTTAGCACAGACCAGG - Intergenic
1050568694 9:6914797-6914819 CCATCTTTGAAGCAGAGCATGGG + Intronic
1050930435 9:11316371-11316393 CCATATTGGAATAAGAGAACTGG + Intergenic
1051352033 9:16206053-16206075 CCATCTTTGAAGCAGAGGCAAGG - Intronic
1051538373 9:18186117-18186139 TCTCCTTGGAAGCAGAGGCCAGG - Intergenic
1051851903 9:21519073-21519095 CCATCTTTGAAGTGAAGACCTGG + Intergenic
1052005318 9:23340717-23340739 CCAGCTTGGAAGCAGAGACAAGG + Intergenic
1052419414 9:28223277-28223299 GAATCTTAGAAGCAGAGAGCAGG - Intronic
1052449507 9:28610597-28610619 TCATCGTGAAAGCAGAGACCAGG + Intronic
1052732257 9:32302310-32302332 CTATCTTGGAAGCAGAAACCAGG + Intergenic
1053033903 9:34808629-34808651 CCATCTTGGAAGTAGAGACCAGG - Intergenic
1053038045 9:34842615-34842637 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1053628672 9:39905502-39905524 CCATTTTAGAAGCAGAAACTGGG + Intergenic
1053777394 9:41560838-41560860 CCATTTTAGAAGCAGAAACTGGG - Intergenic
1053793201 9:41701387-41701409 CCATCTTGGATGCAGAGACCAGG - Intergenic
1054151974 9:61613452-61613474 CTATCTTGGTTGCAGAGACCAGG + Intergenic
1054181610 9:61913399-61913421 CCATCTTGGATGCAGAGACCAGG - Intergenic
1054215215 9:62345200-62345222 CCATTTTAGAAGCAGAAACTGGG - Intergenic
1054471748 9:65544582-65544604 CCATCTTGGATGCAGAGACCAGG + Intergenic
1054672266 9:67810149-67810171 CCATTTTAGAAGCAGAAACTGGG + Intergenic
1054793249 9:69275437-69275459 CCATGTGGGAAGCAAAGACATGG - Intergenic
1055027672 9:71739520-71739542 TCATCTTGGAGGCAGAAAGCTGG + Intronic
1055436636 9:76298228-76298250 GCATTTTGCAAGCAGAAACCAGG + Intronic
1056423323 9:86451721-86451743 CCATCTTGGAAGCTGAAGGCAGG - Intergenic
1056500488 9:87203888-87203910 CCACCTTGGGAGCAGAATCCAGG + Intergenic
1056696221 9:88856265-88856287 GGAGCTTGGAAGCAGAGACTGGG + Intergenic
1056744291 9:89286718-89286740 CCATCTTGTAAGCGGAGACCAGG + Intergenic
1057067932 9:92072833-92072855 CCACATTGGGAGCAGAGACTAGG - Intronic
1057882572 9:98803618-98803640 ACATATTGGAAGGAGAGAGCAGG + Intergenic
1058162182 9:101581581-101581603 CCATCTTGGAAGCAGAGACTGGG + Intronic
1058610558 9:106771223-106771245 CCATCTTGGAAGTAGAGACCAGG + Intergenic
1059261721 9:112983517-112983539 CCATCTTAGAAGCAGAGACTGGG - Intergenic
1060706486 9:125806458-125806480 CCATCCTGGAAGCAGAAGCCTGG - Intronic
1060841733 9:126799039-126799061 CCATCTTGGAAGTAGAGGCTGGG - Intergenic
1061266670 9:129509796-129509818 CCATGTTTGAAGCAGGGAACGGG - Intergenic
1061446416 9:130640696-130640718 CCACCTTGGAAGCAGGTACCTGG - Intergenic
1061711331 9:132490044-132490066 CCATCTTGGAAGCAAAGACTAGG - Intronic
1062145538 9:134987726-134987748 CCATTTTAGAAGCAAAGTCCTGG - Intergenic
1062432095 9:136530776-136530798 TCTTCTTGGGAGCAGAGCCCCGG - Intronic
1185929912 X:4191036-4191058 TCATCTTGGGGGAAGAGACCTGG + Intergenic
1186566331 X:10666826-10666848 CCATAGTGGAAACAGAGAACAGG - Intronic
1186833719 X:13417081-13417103 GCATCTAGTGAGCAGAGACCAGG + Intergenic
1186870810 X:13769807-13769829 CCATCTTGGAAGCCGAGACCGGG + Intergenic
1186963455 X:14762097-14762119 CCCTCTTGGAAGAAGGGAACAGG - Intergenic
1188049046 X:25461946-25461968 ACATCTTGGAAACAGAAACCTGG - Intergenic
1188703864 X:33301639-33301661 TCATCTTCGAAGCAGAGACTGGG - Intronic
1188855888 X:35195302-35195324 ACATCTTGGAAGCAGAAAGCAGG + Intergenic
1189274498 X:39775547-39775569 TCATTTTGGAAGAAGAGACAGGG + Intergenic
1189302616 X:39963267-39963289 CCATCTTGGAAGTGGAGACTGGG + Intergenic
1189971219 X:46420196-46420218 TTACCTTGGAAGCAGAGACTGGG - Intergenic
1190124646 X:47693118-47693140 CCATCTTGGAAGCAGAGACTGGG - Intergenic
1191910690 X:66146281-66146303 CCATCTTGTAAGCAGAGATGGGG + Intergenic
1192094699 X:68198337-68198359 CCATCTTGGAAACAGAGACCAGG + Intronic
1192575796 X:72242194-72242216 CCAGCTGGGAAGCAGAGAGGAGG - Intronic
1193084116 X:77433421-77433443 CCATTTTGGAAGCAGACGCTGGG - Intergenic
1193299947 X:79878179-79878201 CCATCTTTGAAGCAGAGAGCAGG + Intergenic
1193978401 X:88151592-88151614 CTGTCTTGAAAGCAGAGACTGGG - Intergenic
1195956377 X:110335289-110335311 CCACCTTGGGAGCAAAGATCTGG + Intronic
1196538039 X:116870736-116870758 CTATCTTTGAAGAAGAAACCAGG + Intergenic
1196593951 X:117521627-117521649 CCATCTTGGAAGCAGACACCGGG + Intergenic
1196941018 X:120775877-120775899 CTATCTTGGACGTAGAGACCAGG + Intergenic
1197034883 X:121861276-121861298 CCATCTTGGAAGCAAAGACCAGG - Intergenic
1197060428 X:122173127-122173149 TCATCCTGGAAGTAGAGACTGGG + Intergenic
1197106165 X:122719143-122719165 CCATCTTGGAAGCAGAGTGAAGG - Intergenic
1197710138 X:129660128-129660150 CCATCTAGTAAGCACAGACTGGG + Intergenic
1197734020 X:129836666-129836688 TCATCTTGGCAGCAGGGACCAGG + Intronic
1198263089 X:134983912-134983934 CCGTCTTGGAAGCAGACACCAGG + Intergenic
1198574041 X:137990550-137990572 TCATCTTAGAAGCAGAGATGTGG - Intergenic
1198693113 X:139306121-139306143 CCATTTTGGAAGCAGAGAGTAGG - Intergenic
1199333490 X:146589217-146589239 CCATCTTGGAAGCAAAGATGGGG + Intergenic
1200367195 X:155679394-155679416 CCATCTTTGAAGCAGAGAGCAGG - Intergenic
1200890060 Y:8313725-8313747 CCATAGTGGAAGCAGGGTCCAGG - Intergenic
1202167508 Y:22006056-22006078 CCGTCTTGGAAGCAGAGACCAGG + Intergenic
1202169381 Y:22024986-22025008 CCATCTTGGAAGCAGAAACTAGG + Intergenic
1202221984 Y:22561379-22561401 CCATCTTGGAAGCAGAAACTAGG - Intergenic
1202223852 Y:22580313-22580335 CCGTCTTGGAAGCAGAGACCAGG - Intergenic
1202319263 Y:23615348-23615370 CCGTCTTGGAAGCAGAGACCAGG + Intergenic
1202321134 Y:23634288-23634310 CCATCTTGGAAGCAGAAACTAGG + Intergenic
1202549633 Y:26035768-26035790 CCATCTTGGAAGCAGAAACTAGG - Intergenic
1202551506 Y:26054709-26054731 CCGTCTTGGAAGCAGAGACCAGG - Intergenic