ID: 983210879

View in Genome Browser
Species Human (GRCh38)
Location 4:164956660-164956682
Sequence GAATCTTATTTATAACTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983210879_983210885 22 Left 983210879 4:164956660-164956682 CCAACCAGTTATAAATAAGATTC 0: 1
1: 0
2: 2
3: 12
4: 193
Right 983210885 4:164956705-164956727 AATTCTCTTCTGTTAAGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 105
983210879_983210883 20 Left 983210879 4:164956660-164956682 CCAACCAGTTATAAATAAGATTC 0: 1
1: 0
2: 2
3: 12
4: 193
Right 983210883 4:164956703-164956725 GGAATTCTCTTCTGTTAAGGCGG 0: 1
1: 0
2: 1
3: 10
4: 127
983210879_983210882 17 Left 983210879 4:164956660-164956682 CCAACCAGTTATAAATAAGATTC 0: 1
1: 0
2: 2
3: 12
4: 193
Right 983210882 4:164956700-164956722 ACTGGAATTCTCTTCTGTTAAGG 0: 1
1: 0
2: 3
3: 21
4: 171
983210879_983210881 -1 Left 983210879 4:164956660-164956682 CCAACCAGTTATAAATAAGATTC 0: 1
1: 0
2: 2
3: 12
4: 193
Right 983210881 4:164956682-164956704 CAATAAATTAAAACAGCAACTGG 0: 1
1: 1
2: 2
3: 41
4: 555
983210879_983210887 27 Left 983210879 4:164956660-164956682 CCAACCAGTTATAAATAAGATTC 0: 1
1: 0
2: 2
3: 12
4: 193
Right 983210887 4:164956710-164956732 TCTTCTGTTAAGGCGGGGCAGGG 0: 1
1: 0
2: 154
3: 461
4: 254
983210879_983210884 21 Left 983210879 4:164956660-164956682 CCAACCAGTTATAAATAAGATTC 0: 1
1: 0
2: 2
3: 12
4: 193
Right 983210884 4:164956704-164956726 GAATTCTCTTCTGTTAAGGCGGG 0: 1
1: 0
2: 1
3: 12
4: 241
983210879_983210886 26 Left 983210879 4:164956660-164956682 CCAACCAGTTATAAATAAGATTC 0: 1
1: 0
2: 2
3: 12
4: 193
Right 983210886 4:164956709-164956731 CTCTTCTGTTAAGGCGGGGCAGG 0: 1
1: 0
2: 0
3: 183
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983210879 Original CRISPR GAATCTTATTTATAACTGGT TGG (reversed) Intronic
901349080 1:8576434-8576456 GAAACTAATTTTTAACTGGCTGG - Intronic
906017288 1:42593202-42593224 ACCTCTGATTTATAACTGGTTGG - Intronic
907000763 1:50852529-50852551 TGATATTATTTATAAGTGGTAGG + Intronic
910201352 1:84703163-84703185 GAATATTATTTATAGCTAGAAGG - Intergenic
911662774 1:100522303-100522325 GAATATTTTTTATCCCTGGTTGG + Intergenic
913297988 1:117340382-117340404 AAAGGTAATTTATAACTGGTAGG + Intergenic
914924832 1:151875797-151875819 GAATCTCATATATTGCTGGTGGG + Intronic
916269536 1:162925659-162925681 TAATCTGTTTTATAACTGGATGG - Intergenic
917856286 1:179102867-179102889 CAATGTCATTTATAACTGGTAGG + Exonic
919390296 1:196975937-196975959 GAATCTAATTTAGATGTGGTGGG + Intergenic
919673476 1:200358865-200358887 AAATTTCATTTATAATTGGTGGG - Intergenic
919863942 1:201764807-201764829 GAATTTTATGTATAACTGCAAGG + Intronic
919968150 1:202549973-202549995 GAATCTTATTTCTAACATGAAGG + Intronic
920683623 1:208092311-208092333 GACTCTGATGTATAACTGGGTGG - Intronic
920858796 1:209687847-209687869 GAATCTGTTTTATAACTGTTAGG + Intronic
921154117 1:212425302-212425324 GAAACTTATTTATTAATGGCTGG - Intergenic
924005676 1:239608208-239608230 GAATTTTATTTATAACTAAATGG - Intronic
1064206029 10:13324544-13324566 AACTCTCATTTATTACTGGTAGG - Intronic
1065162973 10:22942617-22942639 AACTCTCATTCATAACTGGTGGG + Intronic
1065240661 10:23700518-23700540 GAATCTTATTTGTAATTGTAAGG - Intronic
1066036098 10:31486332-31486354 ATCTCTTATTTATTACTGGTGGG - Intronic
1066052658 10:31649530-31649552 AAAATTTATTTATAACTGCTAGG - Intergenic
1068177535 10:53480816-53480838 GAATCATTTTTATAATTGCTTGG - Intergenic
1068234362 10:54214384-54214406 AAATCTTAATTATAACTGTTTGG + Intronic
1069236294 10:66079074-66079096 AAAGCTTATTTATAACTTGAAGG - Intronic
1072548639 10:96459855-96459877 GATTATTATTTAGAACTGGGGGG + Intronic
1074079801 10:110158397-110158419 GCATCTTGTTTTTACCTGGTTGG + Intergenic
1074726659 10:116317120-116317142 GAATCTTTTTTATGAGTGTTTGG + Intergenic
1075216416 10:120540087-120540109 GAATCTTATTTATAAAGTATGGG - Intronic
1076111053 10:127860118-127860140 GAACCTTATTCATTGCTGGTGGG - Intergenic
1076140525 10:128074874-128074896 GAACCTTATATATTGCTGGTAGG - Intronic
1078967710 11:16366079-16366101 GAATCTTATTTGTTAATGCTTGG - Intronic
1079167594 11:18060567-18060589 GAATTTTATTTACAAATTGTTGG + Intergenic
1080293968 11:30704072-30704094 GAATCTCATTTGTAACTCCTGGG + Intergenic
1081370457 11:42294378-42294400 GAAACTAATTTATTGCTGGTGGG - Intergenic
1082212835 11:49526283-49526305 GAATGTTATTTATAAGAGCTGGG - Intergenic
1085505211 11:77054913-77054935 GATTCTTCTTTATAATTGGATGG + Intergenic
1085505981 11:77059410-77059432 GATTCTTCTTTATAATTGGATGG - Intergenic
1086046745 11:82541858-82541880 TAATCCTATTTAGAAATGGTAGG - Intergenic
1086636761 11:89098226-89098248 GAATGTTATTTATAAGAGCTGGG + Intergenic
1087994912 11:104793482-104793504 AGTTCTGATTTATAACTGGTTGG + Intergenic
1090971885 11:131651336-131651358 AAATGTTTTTAATAACTGGTTGG - Intronic
1091126269 11:133101600-133101622 AACTCTTATTTATTGCTGGTTGG + Intronic
1092666164 12:10801461-10801483 GAATCTTATGTACAGCTGGCTGG - Intergenic
1093553876 12:20447789-20447811 ATCTCTGATTTATAACTGGTTGG + Intronic
1095523144 12:43092565-43092587 GAATCTTATTTGCCAGTGGTGGG - Intergenic
1095749358 12:45694375-45694397 AACTCTGATTTATAGCTGGTTGG - Intergenic
1097152231 12:56987487-56987509 GAAACTATTTCATAACTGGTGGG + Intergenic
1097290455 12:57910175-57910197 GAACTTTATTTTTAACTGGGAGG + Intergenic
1098273697 12:68792905-68792927 CAATATTATTTAGATCTGGTTGG - Intronic
1099158039 12:79204251-79204273 ATATATTATTTCTAACTGGTAGG + Intronic
1099383390 12:81983842-81983864 AACTCTTATTTATTTCTGGTGGG + Intergenic
1099614907 12:84921708-84921730 GAATCTCATTTACTACTGGCAGG + Intergenic
1099778843 12:87168300-87168322 GAATCTAATTTATAAATGGTGGG - Intergenic
1101389705 12:104289322-104289344 AAATGTTATTTACAACTGGGAGG - Intronic
1105493629 13:20911048-20911070 GAAATTTATTTATAAATGTTGGG + Intergenic
1109934046 13:69257995-69258017 GAATGTTATTTGTATTTGGTGGG - Intergenic
1111452830 13:88441334-88441356 GATCCTTATTTATAAGTGGTTGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112554988 13:100458850-100458872 GAATCCTATGTATTACTGTTTGG - Intronic
1112727604 13:102322347-102322369 GGAACATATTTATTACTGGTGGG + Intronic
1117229471 14:53700893-53700915 GAACCTGACTTATAGCTGGTTGG + Intergenic
1117678607 14:58180631-58180653 CATTCTTATTTATTATTGGTGGG + Intronic
1120298098 14:82670789-82670811 AAAACTTATTTTCAACTGGTAGG + Intergenic
1120557222 14:85943902-85943924 GCATCTTATTTTCAGCTGGTAGG + Intergenic
1121142056 14:91551648-91551670 GAATCTTATTTCTTCCTAGTAGG + Intergenic
1121807781 14:96846689-96846711 GAATATTTTTTATCCCTGGTTGG - Intronic
1126480020 15:49108615-49108637 GAACCTTATTTATCAATAGTTGG - Intronic
1131049721 15:89338715-89338737 GAATTTTTTTTAAAACTGGCTGG + Intergenic
1131772299 15:95751754-95751776 GAATATTATTTATGAATGGCTGG + Intergenic
1133875925 16:9734245-9734267 GAATCTTATTTTTAAATGCCCGG - Intergenic
1135157951 16:20070513-20070535 CAGTCTAATTTTTAACTGGTTGG - Intronic
1137416854 16:48290507-48290529 TACTCCAATTTATAACTGGTTGG - Intronic
1139841822 16:69887973-69887995 GAATTTTATTTATACTTGCTAGG - Intronic
1140287109 16:73614272-73614294 GAATTTTATTTGTAAATGGCTGG - Intergenic
1140288721 16:73629789-73629811 CAATCATATTTTTAACTAGTAGG - Intergenic
1146637160 17:34514929-34514951 GACTATTATTCACAACTGGTAGG + Intergenic
1149278658 17:55075627-55075649 AATTCTTATTCATTACTGGTGGG - Intronic
1150899560 17:69256823-69256845 CAATATTATTTATGACTAGTAGG + Intronic
1154259419 18:12816969-12816991 GCCTCTTATTCATGACTGGTAGG - Intronic
1156725396 18:40120426-40120448 CACCCATATTTATAACTGGTTGG + Intergenic
1159572520 18:70134114-70134136 GAAACTTATTTCCAATTGGTGGG + Intronic
1162257926 19:9507803-9507825 TTATCTTATTTAGAATTGGTAGG + Intergenic
1163475011 19:17520849-17520871 GAGTCTTATTTATCCTTGGTTGG + Intronic
1164838714 19:31376155-31376177 GACTCTTATATATTGCTGGTGGG - Intergenic
927824723 2:26300193-26300215 AAGTCTTTTTTAAAACTGGTTGG - Intergenic
928348956 2:30529113-30529135 GAAAATTATTTTTAACTGTTTGG - Intronic
928688449 2:33774301-33774323 GATTCTTCTTTATAACTTGTGGG - Intergenic
928901985 2:36329293-36329315 GAAAAATATTTATACCTGGTAGG + Intergenic
931531878 2:63224270-63224292 GATTCTTATTCATCAATGGTGGG + Intronic
931598127 2:63973141-63973163 AACTCTTATTTATTGCTGGTGGG - Intronic
932992816 2:76809167-76809189 TAATGTTATTTATCACTGGTTGG - Intronic
933883403 2:86694904-86694926 AACTCTTATATATAGCTGGTGGG + Intronic
935419250 2:102850107-102850129 GCTTCTTATTTTTAAGTGGTTGG - Intergenic
941242511 2:163056914-163056936 GACTCTCATTCATTACTGGTGGG - Intergenic
941839946 2:170071105-170071127 AAATCTTATTCATTACTGATAGG + Intronic
942220831 2:173767563-173767585 AATTCTGATTTATAGCTGGTGGG - Intergenic
943023237 2:182599735-182599757 GAAACTTAATTTTAACTGGATGG + Intergenic
943043254 2:182827891-182827913 GAATGTTATTTATAAAAGTTTGG - Intergenic
943185007 2:184597434-184597456 GAATCGTATATATATCTGATGGG + Intergenic
943679056 2:190748742-190748764 GAGCCTGATTTATAGCTGGTTGG - Intergenic
944827720 2:203502493-203502515 GAATTTGATTTATAACTCTTAGG - Intronic
944885694 2:204060426-204060448 GAATCTTATATTTTACTGTTAGG + Intergenic
945777390 2:214123901-214123923 GAATCATATAGATAACTGATTGG + Intronic
945897031 2:215495042-215495064 GAATCTCATTCATTGCTGGTGGG + Intergenic
1170132132 20:13032203-13032225 TGATCTTGTTTATAACTGGCTGG - Intronic
1170338937 20:15301545-15301567 GAATCTTACTTATCAATGGGTGG + Intronic
1174030666 20:47623007-47623029 GATTCTTACTTATAACTGTCAGG - Intronic
1185354561 22:50359698-50359720 GAATCCTTTTTATATGTGGTTGG + Intronic
950995189 3:17488588-17488610 AACTCTTATTTATTGCTGGTGGG - Intronic
952391826 3:32887085-32887107 GAATGTTAATTATAACTGAGGGG + Intronic
956954638 3:74322523-74322545 AACTCTCATTTATCACTGGTGGG + Intronic
956964310 3:74441089-74441111 GAATGTAATTTATAACTTATGGG + Intronic
959260180 3:104068675-104068697 TAATCTTATTTATAACTTACTGG + Intergenic
959436970 3:106327439-106327461 AACTCTCATTTATTACTGGTGGG + Intergenic
959858253 3:111187056-111187078 GACTCTCATTCATTACTGGTGGG + Intronic
960615298 3:119590921-119590943 GAACCTGATTTACAGCTGGTTGG - Intergenic
960856970 3:122111767-122111789 CAAGCTTACTGATAACTGGTAGG + Intronic
964186514 3:153951752-153951774 GCATATTGTTTATTACTGGTGGG - Intergenic
964996648 3:162891054-162891076 AACTCTTATTTATTGCTGGTAGG + Intergenic
967181750 3:186911168-186911190 TAATTTTATTTCTAAATGGTGGG - Intergenic
967308061 3:188077986-188078008 GGATCTTTTGGATAACTGGTTGG + Intergenic
971076335 4:23153438-23153460 GGATCTCATTTTTAACTGGATGG - Intergenic
971998852 4:34002651-34002673 GTATTTTATATATAATTGGTAGG - Intergenic
973652747 4:53012945-53012967 TAATCTTATTTATGACAGGAAGG + Intronic
974291418 4:59936440-59936462 GAGACTTATCTATAACTGGAAGG - Intergenic
975003102 4:69250531-69250553 GCATCCTCTTTATAACTGGAAGG - Intergenic
975589539 4:75986562-75986584 GAATCTAATGCATAACTGGAGGG - Intronic
976229352 4:82824945-82824967 CAATATTGTTTATAACTGATGGG + Intronic
976505617 4:85842950-85842972 GAATCTCATTTACTACCGGTAGG - Intronic
977030898 4:91881781-91881803 AACTCTTATTTATTGCTGGTGGG - Intergenic
977361009 4:96004384-96004406 GGATCTTATGGATAAATGGTTGG - Intergenic
977964706 4:103131483-103131505 GAATTTTATTCATTGCTGGTGGG + Intronic
978045312 4:104118296-104118318 CAATCTGATTTATAACCTGTGGG + Intergenic
979423518 4:120535712-120535734 AAATCTCATTCATCACTGGTGGG - Intergenic
979772290 4:124542853-124542875 GAATCTTAAGTATAAATTGTTGG + Intergenic
981174688 4:141667272-141667294 AACTCTGATTTATAACTGATCGG + Intronic
982987455 4:162229318-162229340 GAATTTTTTTTATAAGAGGTTGG - Intergenic
983207972 4:164930969-164930991 GAATGTTATTTGTAACTGGTGGG + Intergenic
983210879 4:164956660-164956682 GAATCTTATTTATAACTGGTTGG - Intronic
983327803 4:166281291-166281313 GAATCTTATTTAGTATTTGTGGG + Intergenic
985228220 4:187785111-187785133 TGATTTTATTTTTAACTGGTAGG - Intergenic
986265559 5:6187213-6187235 GACCCTGATTTATAGCTGGTTGG + Intergenic
986901117 5:12434825-12434847 AAATGTTATTTATAATTGCTAGG + Intergenic
989154563 5:38332036-38332058 GACTCTCATTCATCACTGGTGGG - Intronic
989215629 5:38901809-38901831 GAACCTCATTTAAAATTGGTGGG + Intronic
989294692 5:39810626-39810648 GAAATTTATATATAACTGATTGG + Intergenic
996426736 5:123320921-123320943 AACTCTGATTTATACCTGGTTGG - Intergenic
997169908 5:131707021-131707043 GATTCTTAATTAAAAGTGGTAGG - Intronic
998845508 5:146305286-146305308 CAATATTATTTATAATTGGTGGG - Intronic
1001538578 5:172519972-172519994 AACTCTTATTCATTACTGGTGGG + Intergenic
1004790709 6:19023124-19023146 CAATTTTGTTTAAAACTGGTAGG + Intergenic
1005007193 6:21299297-21299319 GATTCCTATTTTTAACTGGTGGG + Intergenic
1005648290 6:27863404-27863426 AAACCTCATTTCTAACTGGTGGG + Intronic
1005661689 6:28004731-28004753 GGATTCTATTTATAACTGGCAGG - Intergenic
1012143599 6:95653589-95653611 AATTCTCATTAATAACTGGTGGG + Intergenic
1012293359 6:97487597-97487619 GAATTTTATTAATTGCTGGTGGG - Intergenic
1016227175 6:141752501-141752523 GAATTTTATTGATAATTGGAAGG + Intergenic
1017674627 6:156800041-156800063 AAATCTGCTTTGTAACTGGTGGG - Intronic
1017677901 6:156833332-156833354 AAATCTTATTTAAAACAAGTTGG - Intronic
1017710394 6:157162627-157162649 GAACTTTATTTAAATCTGGTTGG - Intronic
1017911851 6:158800081-158800103 GAATGTTATTTATAACAGGGTGG - Intronic
1017990761 6:159487804-159487826 TAATCTTACTTATATATGGTTGG - Intergenic
1020153101 7:5698755-5698777 GATTCTTCTATATAAGTGGTAGG - Intronic
1023536868 7:41222588-41222610 GAATCTATTTTATAACAGGTTGG - Intergenic
1023553506 7:41394525-41394547 AACTCTTATTTATTGCTGGTAGG - Intergenic
1024144238 7:46495768-46495790 AACTCTTATTCATTACTGGTGGG + Intergenic
1026769334 7:73184562-73184584 GAACCATATTTATAACTAATTGG + Intergenic
1027010204 7:74737945-74737967 GAACCATATTTATAACTAATTGG + Intronic
1027077838 7:75208092-75208114 GAACCATATTTATAACTAATTGG - Intergenic
1028897290 7:96056133-96056155 GAATTTAATTTATGCCTGGTTGG + Intronic
1029858411 7:103542838-103542860 GATTCTTATTAATGAGTGGTGGG - Exonic
1030119023 7:106088282-106088304 AAATCTTACTTATTGCTGGTGGG + Intergenic
1031378432 7:121056197-121056219 GAATGGTATTTATTTCTGGTTGG + Intronic
1031667177 7:124498843-124498865 GAATTTTTTTTATTACTGATAGG + Intergenic
1031795250 7:126165908-126165930 GAAAATTATTTTTAATTGGTAGG + Intergenic
1033043006 7:137935752-137935774 GGCACTTATTTATAACTGTTGGG - Intronic
1033681097 7:143597627-143597649 GAGTCTTATTTATAAATTGCAGG - Intergenic
1033703795 7:143864186-143864208 GAGTCTTATTTATAAATTGCAGG + Intronic
1037418913 8:18681170-18681192 GTATCTTATTTTTTACAGGTTGG + Intronic
1039358849 8:36852238-36852260 GAATCTTTTTTATACATTGTTGG + Intronic
1039534692 8:38298714-38298736 AAATCATTTTTATAACAGGTAGG + Intronic
1040455217 8:47591262-47591284 GAATTTTATTTATAACGTTTTGG + Intronic
1041213623 8:55578105-55578127 GAGCCTTTTTTATAAATGGTTGG - Intergenic
1041793379 8:61721249-61721271 CAATCTTATTTGTAGTTGGTTGG + Intergenic
1043060815 8:75500398-75500420 AAATCTCATGTATTACTGGTTGG + Intronic
1043850932 8:85215823-85215845 AACACTTATTTATAACTGGTTGG + Intronic
1045706384 8:104927773-104927795 GAATCTTTTTGAAAATTGGTAGG + Intronic
1045869061 8:106904692-106904714 AACTCCAATTTATAACTGGTTGG - Intergenic
1051599674 9:18860354-18860376 AAATCTTATTTATAAAGGGGTGG - Intronic
1052656475 9:31369171-31369193 TAATCTCATTTATCACTGTTTGG - Intergenic
1056276702 9:85000872-85000894 AACTCTCATTTATTACTGGTTGG - Intronic
1056863384 9:90207714-90207736 AAATCTTTTTTATAACTTTTAGG + Intergenic
1057209893 9:93194585-93194607 AACTCTTATTCATTACTGGTAGG + Intronic
1187280076 X:17851769-17851791 GACACTTATTTATAGCAGGTTGG - Intronic
1187992023 X:24884861-24884883 TAATGTTAATTATAACTGGTAGG + Intronic
1190784603 X:53632889-53632911 GATTCTTATTCATTACTGCTTGG - Intronic
1191677575 X:63807853-63807875 AAATCTTATATAGAATTGGTTGG - Intergenic
1193693482 X:84678259-84678281 AAATCATATATATAACTAGTAGG - Intergenic
1195209824 X:102643435-102643457 GAAACTTATTTAGTGCTGGTAGG - Intergenic
1195612606 X:106885588-106885610 AACTCTTATTTATGACTGATTGG - Intronic
1197576953 X:128225749-128225771 GAATTGTATTTATAACTTCTGGG + Intergenic
1198009843 X:132540552-132540574 GGATCTTATTTATATCTGCAAGG + Intergenic
1198132407 X:133710450-133710472 GAATCAAATTTCTATCTGGTTGG - Intronic
1199912285 X:152299699-152299721 GAAATTTATTTATAACAAGTGGG - Intronic
1200438348 Y:3180947-3180969 TAATCTTTTTTATAAGTTGTCGG + Intergenic
1202303953 Y:23447918-23447940 GAATCTTATTTCTAACATGAAGG + Intergenic
1202566857 Y:26222673-26222695 GAATCTTATTTCTAACATGAAGG - Intergenic