ID: 983212120

View in Genome Browser
Species Human (GRCh38)
Location 4:164969610-164969632
Sequence ATCACCAGCATCACTGTGTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 2, 1: 1, 2: 1, 3: 10, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983212120_983212122 -1 Left 983212120 4:164969610-164969632 CCAAACACAGTGATGCTGGTGAT 0: 2
1: 1
2: 1
3: 10
4: 195
Right 983212122 4:164969632-164969654 TCAGTGGACAAACTGCACCTTGG 0: 3
1: 0
2: 0
3: 15
4: 132
983212120_983212123 15 Left 983212120 4:164969610-164969632 CCAAACACAGTGATGCTGGTGAT 0: 2
1: 1
2: 1
3: 10
4: 195
Right 983212123 4:164969648-164969670 ACCTTGGACATAAAAGCTCTAGG 0: 3
1: 0
2: 1
3: 24
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983212120 Original CRISPR ATCACCAGCATCACTGTGTT TGG (reversed) Exonic
901172715 1:7273132-7273154 ATCACCATCAGCAGTGTGTGAGG - Intronic
902901548 1:19519924-19519946 ATCAGAAACATCACTGTGGTAGG - Intergenic
904090020 1:27938252-27938274 ATCACAAGCATCCCTCTGCTGGG + Intronic
904968114 1:34396080-34396102 ATCACCCTCATCAATGTGGTGGG + Intergenic
907228042 1:52967853-52967875 ATCACAAGGAACACTGTGCTTGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909597972 1:77428462-77428484 ATCACCTTCATCAGTGTTTTTGG - Intronic
909600336 1:77455264-77455286 ATCACCAATATGACCGTGTTGGG + Intronic
916222650 1:162460445-162460467 ATTACCATCATCCCTGTGCTTGG + Intergenic
916367741 1:164052055-164052077 ACCACCAGCTTCTCTGAGTTGGG - Intergenic
917112220 1:171560074-171560096 ATCAGAAGAATCACTGTGTATGG - Intronic
920014155 1:202892554-202892576 AACACCAGCATCACAGCGCTGGG + Exonic
921387372 1:214584231-214584253 ATCACTAGCAGCACTTTGTATGG - Intergenic
922213675 1:223503924-223503946 ATTACCAGCATCACTTTGTGGGG - Intergenic
924549885 1:245065740-245065762 ATCACCCGCATCGGAGTGTTGGG + Intronic
1065262499 10:23938093-23938115 ATAACCAGCATCTATATGTTGGG + Intronic
1066243338 10:33558835-33558857 CTCACCAGAATCACAGTGATTGG + Intergenic
1070816182 10:79324985-79325007 ATCACCATCATCCCTGGGATGGG - Intergenic
1072790158 10:98311964-98311986 TCCATCAGCATCACAGTGTTAGG + Intergenic
1077543761 11:3160006-3160028 ATCACCACCATCAATCTCTTAGG + Intronic
1077737375 11:4805592-4805614 ATCTCTAGCATCTCTGTGCTTGG + Intronic
1078096201 11:8298791-8298813 ATAACCAGCATCCCGGTGTGGGG - Intergenic
1079599623 11:22295149-22295171 TTCACCAACCTCACTCTGTTTGG - Intergenic
1080589095 11:33705847-33705869 AACACCAGCATCAATATTTTAGG + Intronic
1081602337 11:44503907-44503929 ATCACCATCATCACCGTCATTGG + Intergenic
1081882518 11:46465742-46465764 ATCATGAGCATCACTATTTTGGG - Intronic
1084879681 11:72161814-72161836 ATCCCCACCAGCACTGTGTGAGG - Intergenic
1084885316 11:72200942-72200964 ATCCCCACCAGCACTGTGTGAGG - Intergenic
1085436732 11:76511027-76511049 TTTACCAGCTTCACTGGGTTAGG + Intronic
1085521764 11:77143340-77143362 GTCCACAGCCTCACTGTGTTGGG + Intronic
1088570043 11:111213802-111213824 ATCCCCACCATTACTGTGCTGGG - Intergenic
1090116275 11:123977531-123977553 ATCTACAGCATCACTGTGGCTGG - Exonic
1092601487 12:10071167-10071189 ATCACCAGCATTTCTGAGCTTGG - Exonic
1092855552 12:12670086-12670108 GCCACCAGCATGACTGTGTGGGG + Intronic
1093670893 12:21874391-21874413 ATTACCAGCAACAGTGTGTAAGG - Intronic
1093832913 12:23786801-23786823 ATGACCAGCATCACTGATTTTGG + Intronic
1100521996 12:95384131-95384153 ATCACAAGAAACACTGTGCTTGG - Intergenic
1102274355 12:111568967-111568989 AACTCTAGCTTCACTGTGTTTGG - Intronic
1102936449 12:116901203-116901225 ATCCCCACCAGCACTGTGTGAGG - Intergenic
1107359824 13:39606117-39606139 CTCACCATCATGACTGTCTTCGG + Intergenic
1110732111 13:78890654-78890676 ATCACCACCAGCAATGTGTGAGG - Intergenic
1110970594 13:81756614-81756636 ATCCCCAGCATCATTGTAATGGG + Intergenic
1116420300 14:44724376-44724398 AGCACCTTCAACACTGTGTTTGG + Intergenic
1116861027 14:49995737-49995759 ATCACAAGTTTCACCGTGTTTGG - Intronic
1117604342 14:57411366-57411388 AACAAAAGCATCACTGTGATTGG - Exonic
1120762439 14:88297625-88297647 ATCCCCATCATCACTGGGATTGG - Intronic
1122662590 14:103307756-103307778 GTTACCATCATCACTGTTTTGGG - Intergenic
1126544438 15:49857343-49857365 ATCAGCACCATCACTGTGACAGG + Intergenic
1126701637 15:51373051-51373073 ATCCCCAACATAACAGTGTTGGG - Intronic
1127517693 15:59712434-59712456 AACACTAGCATCTCTGTCTTTGG - Intergenic
1127870335 15:63067792-63067814 ACCAAAAGCATCACTGAGTTTGG + Intronic
1129166844 15:73783325-73783347 ATCACCAGCCTCACTCTGTCTGG + Intergenic
1131381174 15:91965233-91965255 ACCACCAGCATCCCAGTGCTTGG + Intronic
1132333072 15:101025974-101025996 ACCACCAGCACCACGGCGTTTGG - Exonic
1135183497 16:20295046-20295068 ATCCCCAGCTTCACTGAGTTGGG + Intergenic
1138165489 16:54797551-54797573 ATCACCCTCATCAATGTGTGTGG - Intergenic
1138316073 16:56071528-56071550 ATCATCATCATCACTGTACTTGG + Intergenic
1140812709 16:78593646-78593668 ATCACCAGCTTAGCTGTGTGTGG - Intronic
1143064421 17:4233928-4233950 ATAAGCAGCATAACTATGTTTGG + Intronic
1144329220 17:14209252-14209274 ATTGCCAGCATCACTATGTGAGG + Intergenic
1146622643 17:34411470-34411492 ATCCCCAGCCTCACTGAGCTTGG + Intergenic
1147768085 17:42850139-42850161 TTCCCCAGAGTCACTGTGTTTGG - Exonic
1149630451 17:58117540-58117562 ATCACCAGCATCACCATCATCGG - Intergenic
1151142072 17:72003118-72003140 ATCAACAGCATCATAGTGTATGG + Intergenic
1152427429 17:80225810-80225832 CTGATCAGCATCTCTGTGTTTGG + Intronic
1152502539 17:80722187-80722209 ATCATCATCATCATTGAGTTTGG + Intronic
1153419933 18:4893544-4893566 ATCACCATCATCATGGTGTGAGG - Intergenic
1155026666 18:21946945-21946967 ATCACCATCATAACAGTATTGGG + Intergenic
1156213148 18:34968987-34969009 ATCATCATTATCACTGTTTTAGG + Intergenic
1157193880 18:45604333-45604355 ATCAGCAGCATAACTTTGTATGG + Intronic
1157547677 18:48557950-48557972 ATCCCCAGCATAAATATGTTTGG - Intronic
1158471640 18:57742410-57742432 ATCAACAGTATCACTGTGGTGGG + Intronic
1160332291 18:78005445-78005467 ATTTCCAGCATTACAGTGTTTGG - Intergenic
1161275561 19:3414773-3414795 ATCCCCAGCATCACAGAGTCGGG - Intronic
1161457685 19:4377748-4377770 ACCACCGACATCACTGTGTAAGG - Intronic
1162122834 19:8482465-8482487 GTGAGCAGCAGCACTGTGTTTGG + Intronic
1163337193 19:16680787-16680809 GTCATCATCATCACTGTCTTAGG - Intronic
925335152 2:3092886-3092908 ATCCCCACCATCAATGTGTAAGG - Intergenic
927261149 2:21092270-21092292 AACACCCACATCACTGGGTTTGG - Intergenic
927405951 2:22767018-22767040 AGCACCAGCATGGCTGGGTTTGG + Intergenic
929749852 2:44699237-44699259 ATCAGAAGAATCACTGTATTTGG + Intronic
931848850 2:66233165-66233187 ATCACTAACATCACTGTTTAAGG + Intergenic
933166900 2:79086627-79086649 ACCACCAGCATCTCTGTGCTGGG + Intronic
933402236 2:81813058-81813080 GGTACCAGCATCACTGTGGTGGG + Intergenic
935973706 2:108556790-108556812 ATCACAAGCAACACTGTGCCTGG - Intronic
937547697 2:123043967-123043989 ACCCCCAGCATGACTGTATTTGG - Intergenic
938387250 2:130875676-130875698 ATCCCCAGCATGGCAGTGTTGGG - Intronic
938486800 2:131719906-131719928 ACCACCACCATGACTGTGCTGGG + Intergenic
938901064 2:135798717-135798739 ACCCCCAGCATCATAGTGTTTGG - Intronic
940797786 2:158098753-158098775 ATTAACAGCATCTCTGTCTTTGG - Intronic
941998324 2:171622551-171622573 ATCAGCAGCAGCACTTTGGTAGG + Intergenic
942844721 2:180409517-180409539 ATCATGAGCATCAGTATGTTTGG - Intergenic
943219330 2:185084747-185084769 TTCACAAGCATAACTCTGTTAGG - Intergenic
944027105 2:195183503-195183525 ATCACCAGCAGAGCAGTGTTTGG + Intergenic
946686074 2:222271427-222271449 ATCACCATTATTACTATGTTTGG - Intronic
946724287 2:222646931-222646953 ATCACCAGCATCGCTGTGTTTGG - Intronic
947457803 2:230271624-230271646 CACACCATGATCACTGTGTTTGG - Intronic
1168968190 20:1912886-1912908 AGCACCAGCAGCACTGAGCTAGG - Intronic
1171186803 20:23128774-23128796 ACCACCAGCCTCACAGTGGTGGG - Intergenic
1171369923 20:24655589-24655611 AACACCAGCAGCAATGTCTTTGG - Intronic
1174680348 20:52400409-52400431 GTCACCAGCATCACTGAGCGTGG - Intergenic
1174929793 20:54800657-54800679 AACACCAGCATCAGCTTGTTAGG + Intergenic
1176676881 21:9786902-9786924 GTCTCCAGCATCAAGGTGTTAGG - Intergenic
1176947273 21:14998069-14998091 TTCTCCAGTATCTCTGTGTTTGG + Intronic
1178526639 21:33335352-33335374 ATTATCAGCATCCCTGTGCTGGG + Intronic
1180595909 22:16973153-16973175 ATCACCTGCATAACTGTTCTTGG + Intronic
1180754951 22:18155002-18155024 AAGCCCAGCATCACTGTGGTTGG + Intronic
1182780016 22:32860020-32860042 AACACAAGCATCACTGGGCTGGG - Exonic
949961903 3:9319230-9319252 AGAACCAGCATCGCTGGGTTTGG - Intronic
951577849 3:24131894-24131916 AGCCCCAGCTTCACTGTGGTGGG - Intronic
951624809 3:24647360-24647382 ATCCCCAACACAACTGTGTTCGG - Intergenic
952808880 3:37383911-37383933 ATCCCCAGCACAACAGTGTTGGG + Intergenic
953466262 3:43122649-43122671 ATCACCAGCAGCACTGTGTGAGG - Intergenic
953922099 3:46959438-46959460 ACCATCATCATCACTGTGGTTGG - Intronic
954614924 3:51964595-51964617 TTCCCCAGCATCACTGGGTGTGG - Intronic
954711586 3:52507658-52507680 CTCACCAGCTTCACACTGTTGGG - Exonic
955222180 3:57032250-57032272 ATCACCAGTACCACTGTTCTTGG - Intronic
957506255 3:81125270-81125292 ATCACCACCAACACAGTGTCAGG - Intergenic
958635348 3:96737588-96737610 AGCACTAGTAACACTGTGTTAGG + Intergenic
958681782 3:97340887-97340909 ATCTCCAGCATGACTATATTTGG - Intronic
959230799 3:103648292-103648314 ATCCCCAGTGTGACTGTGTTTGG - Intergenic
959841834 3:110985138-110985160 ATCACCAGAAACACTGTGCCTGG - Intergenic
960214188 3:115010347-115010369 ATCACCACTATGACTGTGTTGGG - Intronic
960541082 3:118863787-118863809 ATCACCACTATGACTGTGCTGGG + Intergenic
964828995 3:160862114-160862136 ATCATCATCATCAGTGTGGTAGG - Intronic
965138768 3:164808470-164808492 ATCAGCTGCATCAGGGTGTTGGG + Intergenic
965349845 3:167598805-167598827 AACTACAGCATCACTGGGTTTGG - Intronic
968932452 4:3588448-3588470 ATCCCCAGCAGCACTGTGGAGGG + Intronic
969503036 4:7565558-7565580 ATCACCATCATCATCGTGATTGG - Intronic
971258983 4:25039156-25039178 ACCTCCAGCATCCCTATGTTGGG + Intergenic
971588926 4:28441926-28441948 ACCACTATCATCACTATGTTTGG - Intergenic
972113847 4:35602591-35602613 CTCATCACCATCACTTTGTTGGG + Intergenic
972486297 4:39544195-39544217 ATCACAAGGAACACTGTGCTTGG + Intergenic
972701715 4:41500689-41500711 ATCACCAATATGACTATGTTGGG + Intronic
972851718 4:43057981-43058003 ACCACCACTATCACTGTGCTAGG - Intergenic
974628814 4:64457396-64457418 AGCACAAGGATGACTGTGTTTGG - Intergenic
974964518 4:68744838-68744860 ATCACAAGGAACACTGTGCTTGG + Intergenic
974965137 4:68751076-68751098 ATCACAAGGAACACTGTGCTTGG + Intergenic
978707644 4:111734178-111734200 ATCACCTGCATCACTGACATAGG - Intergenic
980450859 4:132969782-132969804 ATTACCACTAGCACTGTGTTAGG + Intergenic
980978043 4:139629781-139629803 ATCACCACTGTGACTGTGTTTGG - Intergenic
983206503 4:164915936-164915958 ATCACCAGCATCACTGTGTTTGG + Intergenic
983212120 4:164969610-164969632 ATCACCAGCATCACTGTGTTTGG - Exonic
985398658 4:189571881-189571903 GTCTCCAGCATCAAGGTGTTAGG + Intergenic
986339707 5:6778615-6778637 ATCCCCAATATCAGTGTGTTTGG + Intergenic
989059150 5:37392979-37393001 ATAAACAACATCAATGTGTTAGG - Intronic
989441210 5:41474301-41474323 ATCACAAGAAACACTGTGCTTGG + Intronic
991982800 5:72250830-72250852 ATCACAGGCATAACTGTCTTTGG + Intronic
992609912 5:78498353-78498375 ATAAGCAGCATCTCTGTGTGTGG + Intronic
993177331 5:84503386-84503408 ATCACCCTCATCAATGTGGTGGG - Intergenic
995797128 5:115953414-115953436 TTCACCAGCATCTCTCTGCTGGG + Intergenic
995887367 5:116911089-116911111 ATCACCAACATCTCTCTGCTAGG + Intergenic
996646552 5:125824984-125825006 AGCCCCAGCATCACAATGTTTGG - Intergenic
999681981 5:154069079-154069101 TGCAACAGCAACACTGTGTTTGG + Intronic
1000136759 5:158360804-158360826 ATAACCAACCTCACTGGGTTGGG + Intergenic
1000222879 5:159231010-159231032 ATCACCACAAATACTGTGTTAGG - Intergenic
1000455039 5:161438123-161438145 ACCACCACTATGACTGTGTTAGG - Intronic
1001077511 5:168641567-168641589 ATCACAAGCATCTCTGTGATAGG - Intergenic
1001185158 5:169564102-169564124 CTCAGCAGCATCACAATGTTAGG + Intergenic
1001864771 5:175093889-175093911 ATCCCCAACGTGACTGTGTTTGG - Intergenic
1002352702 5:178594316-178594338 CTCACCAGCATCCATGTGTGGGG + Intergenic
1002596037 5:180323992-180324014 AGCACCTGCATGACTGTGGTAGG - Intronic
1005622546 6:27633314-27633336 ATCACAAGAAACACTGTGCTTGG - Intergenic
1007492215 6:42232346-42232368 TTCACTAGCATTACTCTGTTTGG - Intronic
1008943832 6:57075498-57075520 ATTACCACCATCAGTGTTTTAGG + Intergenic
1010279235 6:74004813-74004835 TTCACCTGCTTCACTGTTTTGGG + Intergenic
1012082416 6:94777733-94777755 ATCAAAAGCTTCAATGTGTTTGG + Intergenic
1012679064 6:102154917-102154939 ATCCACAGCATTACTGAGTTTGG + Intergenic
1013194628 6:107834254-107834276 GTCACCAGCAGCACAGGGTTGGG - Intergenic
1014392554 6:120881106-120881128 ATCACCATCATCACTCTTTTTGG + Intergenic
1014525094 6:122493200-122493222 ATCACCAATGTTACTGTGTTAGG + Intronic
1015429327 6:133112359-133112381 ATCACCAACATGATGGTGTTAGG + Intergenic
1015834171 6:137401679-137401701 ATCACCATCAAAACTGTATTAGG - Intergenic
1017369300 6:153686286-153686308 ATCATCATCATTACTGTGGTTGG - Intergenic
1019085211 6:169469049-169469071 ACCCCCAGTATGACTGTGTTTGG - Intronic
1028202319 7:87976269-87976291 ACCCCCAACATGACTGTGTTTGG + Intronic
1028581737 7:92416149-92416171 ATCATCAGACTCACTGTTTTTGG - Intergenic
1031327379 7:120418572-120418594 TTCACCAGTATCTCTGTGTTGGG - Intronic
1031994620 7:128221620-128221642 ATCACCAATGTAACTGTGTTTGG + Intergenic
1034505462 7:151486355-151486377 ATCACCAGTAGCACTGTTGTGGG + Intronic
1036012523 8:4742992-4743014 ACCACATGCTTCACTGTGTTTGG + Intronic
1038500518 8:28039858-28039880 ACCACCAGGGTGACTGTGTTTGG + Intronic
1040280056 8:46036117-46036139 ATCACCAACCTCACTGCTTTAGG - Intergenic
1040885534 8:52259217-52259239 CTCTCCAGCATCACTGAGCTTGG - Intronic
1042295446 8:67212513-67212535 AACACTAGCAGCACAGTGTTGGG + Intronic
1042456698 8:69013656-69013678 ATCCCCAGTATAACTGTCTTTGG + Intergenic
1044105968 8:88207518-88207540 ATCACTAGCAGCACTTTGTATGG - Intronic
1046194626 8:110844500-110844522 ATAAGCAGCTTCATTGTGTTAGG + Intergenic
1046315256 8:112492574-112492596 ATAACCAGCATCACAGTAATAGG + Exonic
1046556572 8:115780262-115780284 ATCATCATCATCACTATATTTGG - Intronic
1049202628 8:141349165-141349187 ATCACCAGTGTGACAGTGTTGGG + Intergenic
1049466808 8:142755101-142755123 AGCAGCAGCATTACTGTGGTTGG - Intergenic
1051353436 9:16219566-16219588 ATCACCTGGATCACAGTGTCAGG - Intronic
1051678893 9:19586767-19586789 ATCACCTGCTTCATTGTTTTAGG + Intronic
1054457674 9:65443448-65443470 ATCCCCAGCAGCACTGTGGAGGG - Intergenic
1054989069 9:71300312-71300334 ATCAGCAGCATCCCTGTCATGGG - Intronic
1055417344 9:76097808-76097830 ATAATCAGCAGCACAGTGTTGGG - Intronic
1056846810 9:90045485-90045507 ATCACTAATATCATTGTGTTAGG - Intergenic
1059325173 9:113499974-113499996 ATCACCATCCTCTCTGTGCTTGG - Intronic
1062026937 9:134344857-134344879 ATCACTACCACCAGTGTGTTGGG - Intronic
1185916204 X:4038157-4038179 ATCACAAGCAACACTGCGCTTGG - Intergenic
1187651955 X:21419814-21419836 ACCACCACCATGACTGTGCTGGG + Intronic
1190479439 X:50861238-50861260 ATCTCCAGCCTCACTGTCTAGGG + Intergenic
1195672906 X:107484246-107484268 TTCCCCAGCAGCACTGGGTTGGG - Intergenic
1196179850 X:112677946-112677968 AAGACCAGCAAAACTGTGTTGGG + Intronic
1196461275 X:115934829-115934851 ACCACCACTATGACTGTGTTGGG + Intergenic
1198175601 X:134151393-134151415 ATCCCTGGTATCACTGTGTTGGG - Intergenic
1198230185 X:134681784-134681806 ATCACCAACATCATTATGGTTGG + Intronic
1199096561 X:143748571-143748593 ATCACCAGCATGACAGTTTGAGG - Intergenic