ID: 983212984

View in Genome Browser
Species Human (GRCh38)
Location 4:164977576-164977598
Sequence CCTTCCTCGCGGGGGCTCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983212984_983213002 21 Left 983212984 4:164977576-164977598 CCACCGAGCCCCCGCGAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 983213002 4:164977620-164977642 AGTGGGCTGCTTCCTGCCTGGGG 0: 1
1: 0
2: 1
3: 40
4: 358
983212984_983213001 20 Left 983212984 4:164977576-164977598 CCACCGAGCCCCCGCGAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 983213001 4:164977619-164977641 AAGTGGGCTGCTTCCTGCCTGGG 0: 1
1: 0
2: 2
3: 24
4: 239
983212984_983212991 3 Left 983212984 4:164977576-164977598 CCACCGAGCCCCCGCGAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 983212991 4:164977602-164977624 CATACCCCAACCCCACCAAGTGG 0: 1
1: 0
2: 1
3: 24
4: 183
983212984_983213000 19 Left 983212984 4:164977576-164977598 CCACCGAGCCCCCGCGAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 983213000 4:164977618-164977640 CAAGTGGGCTGCTTCCTGCCTGG 0: 1
1: 0
2: 1
3: 27
4: 193
983212984_983212992 4 Left 983212984 4:164977576-164977598 CCACCGAGCCCCCGCGAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983212984 Original CRISPR CCTTCCTCGCGGGGGCTCGG TGG (reversed) Exonic
900080891 1:856556-856578 GCTTCCTCCCTGGGGCTCAGTGG + Intergenic
900759877 1:4463420-4463442 CCTTCCTAGCTGGGGCTGGTGGG + Intergenic
901631679 1:10651139-10651161 CCTCCCTCCAGGGGGCACGGCGG - Intronic
901839391 1:11944588-11944610 CCGTCCTGGCAGGAGCTCGGGGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902940805 1:19799393-19799415 CCTTCCTGACGGGGGCGTGGAGG + Intronic
905206195 1:36344091-36344113 CCTGCCTCCCGGGGGGTGGGGGG - Intronic
922373018 1:224929976-224929998 GGTTCCGCGCGGGGACTCGGAGG - Intronic
922753669 1:228082614-228082636 CCTGCGTCGCGGGCGCACGGTGG + Intergenic
1063960041 10:11299454-11299476 CCTTCCTGGGGGGGGTTGGGGGG - Intronic
1067425215 10:46204676-46204698 CTTTCCTAGCGGGGGCCCTGCGG - Intergenic
1067943294 10:50674710-50674732 CTTTCCTAGCGGGGGCCCTGCGG - Intergenic
1068721994 10:60255883-60255905 CCTTCCTCACTGGGGCCCAGAGG + Intronic
1071579714 10:86757362-86757384 CCCTTCCCGCGGGGACTCGGGGG - Intronic
1072070312 10:91908886-91908908 GCCTCCTCGCGGCTGCTCGGAGG - Exonic
1072537871 10:96377012-96377034 CCTTCCTGACTGTGGCTCGGGGG + Intronic
1072727650 10:97824405-97824427 CCTATCTAGTGGGGGCTCGGGGG - Intergenic
1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG + Intergenic
1074772170 10:116741773-116741795 CCTTCCTTGCGGGGGGCAGGGGG - Intronic
1075519630 10:123136018-123136040 CCTCCCTCCCGGGGACCCGGAGG + Exonic
1075651796 10:124132191-124132213 CCTTCCTGGGGGGAGCTGGGAGG + Intergenic
1076891185 10:133284284-133284306 CTTTCCTGGCGTGGGCTCCGAGG - Intronic
1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG + Intergenic
1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG + Intergenic
1077205008 11:1337737-1337759 CCCTCCCCGCGGTGGCTCCGGGG - Intergenic
1081663180 11:44900980-44901002 CCTTCCTCGGCCGGGCGCGGTGG - Intronic
1082076492 11:47980043-47980065 CCTCCCTGGCCGGCGCTCGGGGG + Intergenic
1083389516 11:62337673-62337695 CCTTCGGCGCCGGGGCTTGGAGG + Intronic
1083554371 11:63614208-63614230 ACTTTCTCGCCGGGGCCCGGCGG + Exonic
1092143752 12:6200901-6200923 CCTTCCTCTCTGGCACTCGGAGG - Intronic
1097902159 12:64883876-64883898 GCTTTCTCACGGGGGGTCGGGGG + Intergenic
1101740353 12:107495383-107495405 CCATCCCCGCTGGGGCTTGGGGG - Intronic
1102536796 12:113587850-113587872 CCTTTCTCGCTGGGGCTCAGCGG - Intergenic
1105728241 13:23186650-23186672 CCATCCTCACAGGGGATCGGGGG + Intronic
1106827818 13:33542958-33542980 CCTCCCGCGCGGGAACTCGGCGG - Intergenic
1108053450 13:46465669-46465691 CCTGCCTCGTGGGGGGTGGGGGG - Intergenic
1112173174 13:96994408-96994430 ACTTGCTCGCTGGGCCTCGGAGG - Intronic
1113651159 13:112035143-112035165 CCTTCCTTGCAGGGTCTCAGGGG + Intergenic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1123047749 14:105526923-105526945 CCCTCCTCCCGGGGGCTCCGAGG + Intronic
1123056377 14:105572545-105572567 CCTCCCTCGCTGGGGCTGGAGGG - Intergenic
1123057554 14:105579262-105579284 CCTCCCTCGCTGGGGCTGGAGGG + Intergenic
1123080812 14:105692673-105692695 CCTCCCTCGCTGGGGCTGGAGGG - Intergenic
1123081831 14:105699195-105699217 CCTCCCTCGCTGGGGCTGGAGGG + Intergenic
1123986182 15:25648230-25648252 CCTTCCTCCAGGGGCCTCGAGGG - Intergenic
1132590343 16:723751-723773 CCTGTCTGGCGGGGGCTTGGTGG + Intronic
1134487227 16:14668076-14668098 CCTTCCTCACAGGGACTAGGAGG + Exonic
1136455623 16:30378308-30378330 CCGCCCTCGCGCGGGCTAGGGGG - Exonic
1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG + Intronic
1142409857 16:89910482-89910504 CCTCCCTCGCAGGGACACGGAGG - Intronic
1142994729 17:3753864-3753886 CCTACATCGCGGGGGCTCCACGG - Exonic
1160236142 18:77087996-77088018 CGTTCCTTGCCTGGGCTCGGAGG - Intronic
1160865078 19:1252787-1252809 CCTACATCGCGGGGGCAGGGCGG + Intronic
1161318606 19:3630868-3630890 CCTCCCTCGCGGGGGATCTGAGG + Exonic
1165744827 19:38224327-38224349 CCGTCCCCGCGGGGTCCCGGGGG - Intronic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
1168165671 19:54545799-54545821 CCTTCTTGGCGGGGGGTGGGTGG - Intergenic
1168349983 19:55670154-55670176 CCTTCCACGATGGGGCTCAGGGG - Intronic
932682338 2:73836698-73836720 TCTTCCTCCCTGGGGCTCAGAGG + Intronic
933040478 2:77458673-77458695 CCTTCCTTGCAGAGGTTCGGTGG + Intronic
935276623 2:101480903-101480925 GCTTCCTCCCGTGGGCTCTGTGG - Intergenic
936461957 2:112720920-112720942 CCTCCCTCAAAGGGGCTCGGGGG + Intergenic
946724434 2:222648074-222648096 CCTTCCTCGCGGGGGCTTGATGG - Intronic
948806738 2:240456337-240456359 CCTCCCTCGCGAGGTCCCGGCGG - Intronic
1173443561 20:43098033-43098055 CCTTCCTCACGTGGCTTCGGGGG - Intronic
1173646302 20:44635197-44635219 CCTTCCTCGCTGGGGAACAGGGG + Intronic
1175847594 20:62066480-62066502 GCTTCCCCGCGGCGGCTTGGAGG - Intergenic
1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG + Exonic
1179794309 21:43773871-43773893 CCTTCCCCTCGGGGGCATGGAGG - Exonic
1181985786 22:26799128-26799150 CCTGCCTGGGGGGGGCTCTGGGG - Intergenic
1183238935 22:36641246-36641268 CCTTCCCCTCGTGGGCTCTGCGG - Intronic
1183736630 22:39648239-39648261 CCATCCAGGCGTGGGCTCGGAGG + Intronic
1185219760 22:49623459-49623481 CCTGCCCAGCGGGGGCTCTGGGG - Intronic
952706258 3:36380653-36380675 CCGTCCTCGCGGGGGCTGCTCGG - Exonic
961743254 3:129046858-129046880 CCTTCGTCGTCGGGGCACGGCGG + Intergenic
962325493 3:134428709-134428731 ACTTCCCTGCTGGGGCTCGGGGG - Intergenic
963221587 3:142818936-142818958 CCTTCCTCGAGGGGCCTCCAGGG + Intronic
969365835 4:6693891-6693913 CCTTCCTCCTGGGGGCTGGCAGG - Exonic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
985567131 5:624711-624733 CCTGCCTGGCGGGGACTCCGTGG + Intronic
985995458 5:3595016-3595038 CCCCCTTCGCGGGGGCGCGGGGG + Intergenic
987399884 5:17464025-17464047 CCCTCCTCCCGGAGGTTCGGTGG + Intergenic
990327729 5:54694683-54694705 GCTTCCTGGAGGGGGCTCTGAGG + Intergenic
994171401 5:96662602-96662624 CCTGCCCCGCGGGGGCGCCGGGG - Intronic
1001303414 5:170554300-170554322 CCTTCCTCTCGGAGGCTCCAGGG - Intronic
1005048499 6:21664361-21664383 CCTGCCTCGCGGCTGCTCGCTGG + Intergenic
1019943328 7:4308196-4308218 CCTTCCTCCCGTTGGCTCTGCGG + Intergenic
1020106594 7:5424973-5424995 CCTCCCTGGAGGGGGCGCGGCGG - Intronic
1022739652 7:33109109-33109131 GCCTGCTCGCGGGGGCTCGGAGG + Intronic
1029496309 7:100896940-100896962 TCTCCCACGCGGGGTCTCGGGGG - Intronic
1035524377 8:300906-300928 GCTTCCTCCCTGGGGCTCAGTGG - Intergenic
1037754081 8:21700312-21700334 CCTGCCTCCCTGGGGCTCTGTGG - Intronic
1041094019 8:54331473-54331495 CCTTCCTCTAGGGTGCTCAGAGG - Intergenic
1044242491 8:89902841-89902863 ACTTCCTCGCCGGGGATGGGAGG + Intronic
1045282046 8:100757807-100757829 CCTTCCTCGCTGGGGACCGCAGG + Intergenic
1049243024 8:141548376-141548398 CCTCCCTCTCTGGGGCACGGAGG - Intergenic
1049807764 8:144548599-144548621 CCTTCCTCGCTGGGGCCCTGTGG + Intronic
1061680844 9:132241801-132241823 CCTGCTTCGCAGGAGCTCGGAGG + Intronic
1062579887 9:137224803-137224825 CCTGCCTCGCCGGGGCTTTGAGG + Exonic
1203774672 EBV:66073-66095 CCTGCCTCCCGGAGGCTCTGCGG + Intergenic
1187499507 X:19828008-19828030 CCCTCCTGGCGGGGGATGGGGGG - Intronic
1189320437 X:40083993-40084015 CATTCCCCGGGTGGGCTCGGCGG - Intronic
1194044253 X:88982431-88982453 CCTGCCTCGCGGCTGGTCGGGGG - Intergenic
1199574110 X:149296915-149296937 CCTTCCTCTCTGGGCCTCTGTGG + Intergenic