ID: 983212992

View in Genome Browser
Species Human (GRCh38)
Location 4:164977603-164977625
Sequence ATACCCCAACCCCACCAAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 184}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983212989_983212992 -6 Left 983212989 4:164977586-164977608 CCCGCGAGGAAGGACTCATACCC 0: 1
1: 1
2: 0
3: 4
4: 61
Right 983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 184
983212986_983212992 1 Left 983212986 4:164977579-164977601 CCGAGCCCCCGCGAGGAAGGACT 0: 1
1: 0
2: 0
3: 9
4: 75
Right 983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 184
983212984_983212992 4 Left 983212984 4:164977576-164977598 CCACCGAGCCCCCGCGAGGAAGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 184
983212988_983212992 -5 Left 983212988 4:164977585-164977607 CCCCGCGAGGAAGGACTCATACC 0: 1
1: 1
2: 0
3: 1
4: 38
Right 983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 184
983212983_983212992 5 Left 983212983 4:164977575-164977597 CCCACCGAGCCCCCGCGAGGAAG 0: 1
1: 0
2: 1
3: 4
4: 46
Right 983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 184
983212981_983212992 22 Left 983212981 4:164977558-164977580 CCAAAGAATACTCAGGACCCACC 0: 1
1: 0
2: 0
3: 12
4: 101
Right 983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 184
983212987_983212992 -4 Left 983212987 4:164977584-164977606 CCCCCGCGAGGAAGGACTCATAC 0: 1
1: 1
2: 0
3: 0
4: 31
Right 983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 184
983212980_983212992 26 Left 983212980 4:164977554-164977576 CCGGCCAAAGAATACTCAGGACC 0: 1
1: 0
2: 1
3: 16
4: 231
Right 983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 184
983212990_983212992 -7 Left 983212990 4:164977587-164977609 CCGCGAGGAAGGACTCATACCCC 0: 1
1: 1
2: 0
3: 4
4: 69
Right 983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG 0: 1
1: 0
2: 1
3: 32
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983212992 Original CRISPR ATACCCCAACCCCACCAAGT GGG Exonic
900175753 1:1290703-1290725 ACACCCCCACCCCACCACTTTGG - Intronic
902323371 1:15683707-15683729 AGACCCCAACCCCACCTGCTGGG - Intergenic
902630485 1:17701719-17701741 TTGCCCCAACCCCACCCCGTGGG + Intergenic
906011709 1:42533101-42533123 ACAGTCCAACCCCACCCAGTGGG - Intronic
907728206 1:57040180-57040202 CTTCCCCAACCCCACGATGTAGG - Intronic
907982588 1:59498711-59498733 ATCCCCCTCCCCCACCAACTGGG + Intronic
909478280 1:76107080-76107102 CCAACCCAACCCCACCCAGTTGG - Intronic
909723556 1:78806737-78806759 ATACCCCAACATCACGAAGATGG + Intergenic
911391661 1:97252349-97252371 ATATCCTTTCCCCACCAAGTTGG - Intronic
915087197 1:153396834-153396856 TTACCCCATCCCCTCCCAGTGGG - Intergenic
915438661 1:155929348-155929370 ATACTGCAGCCCCACTAAGTCGG + Exonic
916230953 1:162540810-162540832 GTACCCCAACTTTACCAAGTTGG - Intergenic
916298655 1:163248920-163248942 ATAGCCCACCTCAACCAAGTGGG + Intronic
919856130 1:201707410-201707432 TCACAGCAACCCCACCAAGTGGG + Intronic
920805221 1:209227354-209227376 TTTCCCCAACCCCACCAGGATGG + Intergenic
923771581 1:236942279-236942301 ATACCCCACCCCAACCAAGGAGG + Intergenic
1063162761 10:3431626-3431648 CTACCCTAACCCCACCCATTTGG + Intergenic
1063403655 10:5772207-5772229 TGACCCCAACCCCACAAAGGTGG + Intronic
1064397206 10:14991544-14991566 ATTCCCCAAACCCAGCAAGGTGG + Intergenic
1064400101 10:15014014-15014036 ATTCCCCAAGCCCACCAAGGTGG + Intergenic
1066390417 10:34973615-34973637 ATTCCCCAAACCCACCAAGGTGG - Intergenic
1069818621 10:71214055-71214077 GTACCCGAACCCAAGCAAGTGGG + Intronic
1070427590 10:76304529-76304551 ATACCCCAACCCCTGCAAACAGG - Intronic
1070800046 10:79239897-79239919 CCACCCCAACCCCACCCAGTTGG + Intronic
1075120706 10:119662592-119662614 ATACCCCAGGCCTGCCAAGTCGG + Intronic
1076719498 10:132387008-132387030 ATACCCCAAGTCCACCAGGGAGG - Intergenic
1082625191 11:55476251-55476273 AGACCTCAACACCACCAAATAGG - Intergenic
1082959028 11:58901575-58901597 TTCCCCCACCCCCACCAAGAGGG + Intronic
1083725134 11:64623900-64623922 ACAGCCCAACCCCACCCAGCTGG - Intronic
1084227693 11:67727523-67727545 ATTCCCCAAACCCAGCAAGGTGG + Intergenic
1084244713 11:67849020-67849042 ATTCCCTAAACCCACCAAGGTGG + Intergenic
1084261099 11:67979210-67979232 ATTCCCCAAGCCCACCAAGGTGG + Intergenic
1084807533 11:71589344-71589366 ATTCCCCAAACCCAGCAAGGTGG - Intronic
1084811553 11:71614885-71614907 ATTCCCCAAGCCCACCAAGGTGG - Intergenic
1084827971 11:71745536-71745558 ATTCCCTAAACCCACCAAGGTGG - Intergenic
1084847483 11:71911807-71911829 ATTCCCCAAACCCAGCAAGATGG - Intronic
1085299104 11:75448157-75448179 ACACCCCCACCCTGCCAAGTGGG - Intronic
1086319373 11:85628603-85628625 ATACCCGAACACCACCATTTTGG - Exonic
1087140147 11:94757040-94757062 ATCCCCCCACCCCAACAAATAGG - Intronic
1087623089 11:100564788-100564810 ATACCCAAACCACAGCAAGAAGG + Intergenic
1088450715 11:109978443-109978465 ATACGCCAACCGTACCATGTTGG - Intergenic
1096508991 12:52116732-52116754 ATTCCCCAAACCCAGCAAGGTGG + Intergenic
1096576336 12:52555162-52555184 AAACCCAAACCCCACCAAAAGGG + Intergenic
1096902073 12:54894022-54894044 ATACCCCACCCCCAATATGTGGG + Intergenic
1097600200 12:61682138-61682160 ATTCCTCATCCCCTCCAAGTCGG + Intergenic
1101648388 12:106652699-106652721 ATACCCAAACCCCACAGAGGGGG - Intronic
1103443515 12:120979939-120979961 ATCCCCCACCCCCACTAGGTGGG - Intronic
1104429879 12:128707348-128707370 ATAGACCAAGCCCACCAGGTTGG - Exonic
1110013747 13:70372445-70372467 ATACCCCTACCTCACTAAATGGG - Intergenic
1111327525 13:86718890-86718912 TGACCCCAACACCACCCAGTAGG - Intergenic
1112785075 13:102942883-102942905 ATACCAGAACCCAACCATGTTGG - Intergenic
1114429162 14:22645642-22645664 CCACCCCAACCCTCCCAAGTGGG - Intergenic
1117038813 14:51751807-51751829 ATTCCCCAAGCCCACCAAGGTGG - Intergenic
1120647385 14:87089898-87089920 ACACCCCAAACCAATCAAGTAGG - Intergenic
1121635272 14:95449893-95449915 CCACCCCAGCCCCACCCAGTTGG + Intronic
1121770365 14:96530497-96530519 CTACCTCAGCCCCCCCAAGTAGG + Intronic
1123133467 14:106006935-106006957 ACAGCCCAGCCCCACCGAGTCGG + Intergenic
1123135853 14:106026908-106026930 ACAGCCCAGCCCCACCGAGTCGG + Intergenic
1123165211 14:106319613-106319635 ACAGCCCAGCCCCACCGAGTTGG + Intergenic
1123583490 15:21737381-21737403 ACAGCCCAGCCCCACCGAGTTGG + Intergenic
1123620140 15:22179984-22180006 ACAGCCCAGCCCCACCGAGTTGG + Intergenic
1123987145 15:25656038-25656060 AGACCCCCCCCCCCCCAAGTAGG - Intergenic
1127800725 15:62475056-62475078 ATACCCCACCCTCACTAAATGGG - Intronic
1127807050 15:62530916-62530938 AGACCCCAACACCACCTAATAGG - Intronic
1132950694 16:2560680-2560702 AGGCCCCACCACCACCAAGTGGG - Intronic
1132963656 16:2639490-2639512 AGGCCCCACCACCACCAAGTGGG + Intergenic
1135494633 16:22940688-22940710 CCACCCCAACCCCACAAAGTAGG - Intergenic
1135664706 16:24326074-24326096 AGCCCCCAACCCCCCCACGTTGG - Intronic
1135715397 16:24760702-24760724 AAACACCACCACCACCAAGTAGG - Intronic
1135732596 16:24907183-24907205 CTGCCCCAGCCCCACCCAGTGGG - Intronic
1137391299 16:48083521-48083543 CAACCCCAAGCCCACCAAGTGGG + Exonic
1137673037 16:50290590-50290612 ATAGCCCAGCGCCACCAAGCAGG - Exonic
1145864832 17:28234372-28234394 ATTCCGCAAACCCACCAAGGTGG + Intergenic
1146916439 17:36681178-36681200 TTCCCCCAACCCCTCAAAGTAGG + Intergenic
1148000307 17:44383859-44383881 ATGCCCCACCCCTACCCAGTTGG - Intronic
1148395154 17:47302339-47302361 ATACCCCCACCTCACAAGGTCGG - Intronic
1148625642 17:49067103-49067125 ATTTCTAAACCCCACCAAGTGGG + Intergenic
1148648362 17:49231933-49231955 ATACCCCAGCCCTACCAGCTGGG - Intergenic
1149838005 17:59931495-59931517 ATCCCCCTACCCCACTAATTTGG + Intronic
1150081285 17:62241741-62241763 ATCCCCCTACCCCACTAATTTGG - Intergenic
1154043739 18:10884593-10884615 ATACCCCACCTCCACGAAGCAGG - Intronic
1154108315 18:11544578-11544600 ACAACCAACCCCCACCAAGTGGG - Intergenic
1155382789 18:25242814-25242836 ATTCCCCAACCCCTCTAAGGGGG - Intronic
1156547384 18:37978332-37978354 ATATCCCAACACCACCACATTGG + Intergenic
1158392284 18:57053255-57053277 ATCCCCCAACTCCACCTGGTAGG + Intergenic
1158664235 18:59418090-59418112 ATATCCCAACCCTATCAAATGGG + Intergenic
1160662644 19:308298-308320 ATACCCCAACCTCACCATACGGG + Intronic
1161397487 19:4052365-4052387 GTACCCCAACCTCACCAAGGAGG + Intronic
1163966355 19:20750692-20750714 ATTCCCCAAACCCACCAAGGTGG + Intronic
1168622761 19:57892360-57892382 AGACTCTAACTCCACCAAGTTGG - Intronic
927464705 2:23328572-23328594 ATCCCCCCACCCCACCAGATGGG + Intergenic
929033193 2:37667801-37667823 ATACCACACCCCCACCAATGGGG - Intronic
930243479 2:48959649-48959671 TTGCTCCAACCCCACCAAGGAGG + Intergenic
932349961 2:71023731-71023753 ATTCCCCAAACCCAGCAAGGTGG - Intergenic
932353456 2:71049857-71049879 ATTCCCCAAACCCAGCAAGGTGG - Intergenic
937316921 2:120937585-120937607 TTTCCCCAACCCCACCCACTGGG + Intronic
937889073 2:126922068-126922090 ATACCCCAAGCCCTCCAAGAAGG + Intergenic
940874424 2:158885494-158885516 ATTCCCCAAACCCAGCAAGGTGG - Intergenic
944461692 2:199956140-199956162 ATTCTCCAACCCCATCAACTGGG + Exonic
946402641 2:219476709-219476731 ACCCCCCACCCCCACCAACTGGG - Intronic
947595021 2:231405652-231405674 ATTCCCCAAGCCCACCAAGGTGG - Intergenic
948382636 2:237561430-237561452 TTACCCCACCCCCACGAAGAAGG - Intergenic
1171408564 20:24930370-24930392 ATTCCCCAAACCCACCAAGATGG - Intergenic
1171500023 20:25585850-25585872 ATACCCCAAACCCACCACTGAGG + Intergenic
1172307235 20:33889277-33889299 ACACCCCAGCCCCAGCAACTGGG - Intergenic
1173066966 20:39722383-39722405 ATCCACCAACCCCAAAAAGTTGG - Intergenic
1173550595 20:43930600-43930622 ATACCCCAGCCCAAGCAACTGGG - Intronic
1174035098 20:47663911-47663933 TTACCGCAACTCCACCAAGCAGG - Intronic
1175928293 20:62481309-62481331 GCTCCCCAACCCCACCCAGTTGG - Intergenic
1178377137 21:32076186-32076208 ACACCCCACCCCCACAAAGTAGG - Intergenic
1180832616 22:18913662-18913684 ATACCCCAGCCCCACCTTGCAGG - Intronic
1180902841 22:19387020-19387042 ATACACACAACCCACCAAGTGGG + Intronic
1184096128 22:42317542-42317564 ATACCCCCATCTCACCAAGGTGG + Intronic
1185194851 22:49462815-49462837 TTCCCCCAAACCCACCATGTTGG - Intronic
1203282702 22_KI270734v1_random:138967-138989 ATACCCCAGCCCCACCTTGCAGG - Intergenic
949292186 3:2479911-2479933 ATACACCACCACCACCAAGTGGG + Intronic
949601276 3:5600705-5600727 CCACCCCAGCCCCACCCAGTAGG + Intergenic
949884579 3:8683092-8683114 ATTCCCCAAACCCAGCAAGGTGG - Intronic
952224357 3:31359279-31359301 ATGCCTCAACTCCAACAAGTTGG + Intergenic
955541079 3:59976975-59976997 AGACCCCAACCCCAACCAGGTGG - Intronic
956287893 3:67629642-67629664 CTACCCCAACACCTCTAAGTAGG - Intronic
957044373 3:75362588-75362610 ATTCCCCAAACCCAGCAAGGTGG + Intergenic
957076169 3:75604771-75604793 ATTCCCCAAACCCAGCAAGGTGG + Intergenic
957148074 3:76449462-76449484 CTACCCCTACCCCAGCATGTAGG - Intronic
959491099 3:106989424-106989446 ATGCCCCATCCCCACCAACCAGG + Intergenic
961272267 3:125698174-125698196 ATTCCCCAAACCCAGCAAGGTGG - Intergenic
961275129 3:125720411-125720433 ATTCCCCAAACCCAGCAAGGTGG - Intergenic
961278046 3:125743034-125743056 ATTCCCCAAACCCAGCAAGATGG - Intergenic
961876367 3:130026622-130026644 ATTCCCCAAACCCAGCAAGGTGG + Intergenic
962039791 3:131694681-131694703 CTACCCCAGGACCACCAAGTAGG + Intronic
965154329 3:165027602-165027624 ATAGCCCAACATGACCAAGTGGG + Intronic
968342214 3:197965800-197965822 CCACCTCAGCCCCACCAAGTAGG - Intronic
968988637 4:3893828-3893850 ATTCCCCAAACCCAGCAAGGTGG + Intergenic
969019620 4:4131071-4131093 ATTCCCCAAACCCAGCAAGATGG + Intergenic
969024322 4:4161471-4161493 ATTCCCCAAACCCAGCAAGGTGG + Intergenic
969025230 4:4167417-4167439 ATTCCCCAAGCCCACCAAGGTGG + Intergenic
969425143 4:7119940-7119962 ATACCCCAACCACATCAAGGGGG - Intergenic
969729495 4:8945694-8945716 ATTCCCCAAACCCAGCAAGGTGG - Intergenic
969734238 4:8976336-8976358 ATTCCCCAAGCCCACCAAGGTGG - Intergenic
969749939 4:9102362-9102384 ATTCCCTAAACCCACCAAGGTGG - Intergenic
969789082 4:9479633-9479655 ATTCCCCAAGCCCAGCAAGGTGG - Intergenic
969793821 4:9510401-9510423 ATTCCCCAAACCCAGCAAGGTGG - Intergenic
969884278 4:10201419-10201441 CTACCTCAACACCACCAAGTGGG - Intergenic
974572975 4:63678808-63678830 ATACCCCAACGGCAGCAAGGAGG - Intergenic
982321797 4:154084572-154084594 AAGCCCCAACCCCAGCAAGCTGG - Intergenic
982817019 4:159898329-159898351 AAACCCAAACCCCGCCAATTAGG - Intergenic
983212992 4:164977603-164977625 ATACCCCAACCCCACCAAGTGGG + Exonic
986879595 5:12153802-12153824 ATGCCCCTCCCCCACCAAGCTGG - Intergenic
992417457 5:76565636-76565658 ATGCCCCATCCCCAGCAAATGGG + Intronic
993461749 5:88190608-88190630 ATTCCCCAAACCCACCAAGGTGG + Intronic
999306400 5:150522251-150522273 ATACTCCACCACCACCAAGAGGG - Intronic
999543013 5:152595201-152595223 ATACCCCAACCCCTCTGATTAGG + Intergenic
999809721 5:155115986-155116008 AGACCCCGAACCCACCAATTCGG + Intergenic
999919389 5:156302737-156302759 ATAACCCAAGACCACCAAGGTGG - Intronic
1000895416 5:166849160-166849182 CTACTCCACCCCGACCAAGTAGG - Intergenic
1002171497 5:177377232-177377254 ACTCCCCAACCCCACCAGGTGGG + Intergenic
1002376725 5:178794502-178794524 GCACCCCAACCCCACCATGGAGG + Intergenic
1006382488 6:33707946-33707968 CCACCCTAAACCCACCAAGTGGG - Intronic
1007224533 6:40303419-40303441 CTACCCCACCCCCACCTAGCAGG - Intergenic
1011443468 6:87412087-87412109 ATTCCCCAACTCAACTAAGTTGG + Intronic
1015696805 6:135989785-135989807 AAACCAGAAACCCACCAAGTGGG - Intronic
1017325429 6:153136360-153136382 ACTTCCCAACACCACCAAGTTGG - Intergenic
1019579320 7:1752268-1752290 AGACCCCGACCCCACCCAGAGGG + Intergenic
1020306999 7:6843098-6843120 ATTCCCCAAGCCCACCAAGGTGG + Intergenic
1020311482 7:6871942-6871964 ATTCCCCAAACCCAGCAAGGTGG + Intergenic
1020323049 7:6954280-6954302 ATTCCCTAAACCCACCAAGGTGG + Intergenic
1020857832 7:13451409-13451431 AGGCCCCAAACCCTCCAAGTAGG - Intergenic
1026989420 7:74575129-74575151 ATCCCCCCGCCCCACCATGTAGG - Intronic
1029078154 7:97952042-97952064 ATTCCCCAAGCCCACCAAGGTGG + Intergenic
1029186754 7:98744847-98744869 ATACCCCAAAATCACCACGTAGG - Intergenic
1029493036 7:100882525-100882547 ATGACCCAACACCAACAAGTGGG - Intronic
1032097788 7:128948057-128948079 ATGCCCCAACCCCATCCAGCGGG + Exonic
1032906916 7:136378863-136378885 ATACCCCTTCCCCACCAAAGGGG - Intergenic
1033062758 7:138123825-138123847 AGACTCCAACCTCACCAAGCGGG - Intergenic
1034094568 7:148395295-148395317 ATACACACACCCCACCAAGAAGG - Intronic
1034521831 7:151626280-151626302 ACAACCCTACCTCACCAAGTCGG + Intronic
1036239851 8:7072461-7072483 ATTCCCCAAGCCCACCAAGTTGG - Intergenic
1036373013 8:8176702-8176724 ATTCCCTAAACCCACCAAGGTGG - Intergenic
1036799554 8:11779999-11780021 AGTCCCAAACCCCACCAAGCAGG - Intronic
1036816592 8:11907157-11907179 ATTCCCCAAACCCATCAAGGTGG + Intergenic
1036877892 8:12488939-12488961 ATTCCCTAAACCCACCAAGGTGG + Intergenic
1036905983 8:12708783-12708805 GTTCCCCAAACCCACCAAGGTGG + Intergenic
1037254260 8:16934552-16934574 ATTCCCCCACCCCACCTAGCAGG - Intergenic
1038628309 8:29216174-29216196 ATACACCAACCCTACAAGGTAGG + Intronic
1038799144 8:30733510-30733532 ATTCCCCAAACCCACCAAGGTGG - Intronic
1039814568 8:41081633-41081655 ACACCCCACCCCCACCAACTTGG - Intergenic
1042415663 8:68514813-68514835 ATACCCCAACTCCAACTATTTGG - Intronic
1043232949 8:77825455-77825477 CTGCCTCAGCCCCACCAAGTAGG + Intergenic
1043487356 8:80711053-80711075 ATACCCCAAGCTCACCCAGGTGG - Intronic
1044962245 8:97542694-97542716 AAACCCCACCCCTTCCAAGTTGG + Intergenic
1048446570 8:134497538-134497560 CCACCCCAACCCTACCAAATCGG - Intronic
1048704976 8:137143537-137143559 ATCTCCCAACACCACCAAATTGG - Intergenic
1048957356 8:139548008-139548030 ATTCCCCAAACCCACCAAGGTGG + Intergenic
1050130556 9:2407347-2407369 ATACCCCTTCCTCACCATGTTGG + Intergenic
1050723555 9:8619739-8619761 ATACCTTAACTCCACCAAGAGGG - Intronic
1056865866 9:90226969-90226991 ATTCCCCAAACCCAGCAAGGTGG - Intergenic
1056917154 9:90755938-90755960 ATTCCCCAAACCCAGCAAGGTGG + Intergenic
1059312407 9:113397400-113397422 ATAACCCCACCCTACCAAGGAGG - Intronic
1059689657 9:116672802-116672824 GAACCCCAACACCACCCAGTTGG - Intronic
1062224066 9:135439090-135439112 ATTCCCCAAACCCACCAAGGTGG + Intergenic
1186498485 X:10031838-10031860 GCACCCCATCCCCCCCAAGTGGG - Intronic
1188593201 X:31864453-31864475 ATACCCCTACAGCAGCAAGTTGG - Intronic
1189482174 X:41400419-41400441 TTACCCAAACCCCACTAAGATGG - Intergenic
1190288787 X:48978154-48978176 TTTCCCCAAGCCCACCAACTTGG - Intronic
1191871991 X:65754320-65754342 ATACACACAACCCACCAAGTAGG + Intergenic
1192298176 X:69871684-69871706 ATCCCTCAATCCAACCAAGTTGG + Intronic
1194400570 X:93434593-93434615 ATTCCCCAAACCCACCAAGGTGG - Intergenic
1194981600 X:100446887-100446909 AGGCACCAGCCCCACCAAGTGGG + Intergenic
1195047773 X:101069372-101069394 ATACAGCAACCCCCCAAAGTAGG - Intergenic
1195348085 X:103971329-103971351 ATACTGTAACCCAACCAAGTCGG + Intergenic
1195359357 X:104067512-104067534 ATACTGTAACCCAACCAAGTCGG - Intergenic
1198392203 X:136187690-136187712 ATACCCCACCCCCACCCCGTGGG - Intronic
1199592600 X:149480978-149481000 TTTCCCCAACCCCACTAAGCTGG - Intergenic
1199844496 X:151680876-151680898 ACACCCCACCGCCACCAATTTGG + Intergenic
1201857809 Y:18564636-18564658 ATAGCCCAGCCCCAGCAAGCAGG - Intronic
1201875512 Y:18755745-18755767 ATAGCCCAGCCCCAGCAAGCAGG + Intronic
1202335188 Y:23801311-23801333 ATGCCCCTCCCCCACCAAGTTGG - Intergenic
1202535579 Y:25868748-25868770 ATGCCCCTCCCCCACCAAGTTGG + Intergenic