ID: 983215339

View in Genome Browser
Species Human (GRCh38)
Location 4:164997395-164997417
Sequence ATTGATAAGCTACTGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983215339_983215346 29 Left 983215339 4:164997395-164997417 CCAACCACCAGTAGCTTATCAAT No data
Right 983215346 4:164997447-164997469 CCACCCCCAGAAAGTCAGTATGG 0: 23
1: 6
2: 5
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983215339 Original CRISPR ATTGATAAGCTACTGGTGGT TGG (reversed) Intergenic
No off target data available for this crispr