ID: 983217647

View in Genome Browser
Species Human (GRCh38)
Location 4:165017021-165017043
Sequence TAGTGAGGACAGATGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 354}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983217647_983217652 -1 Left 983217647 4:165017021-165017043 CCCTGTCCCATCTGTCCTCACTA 0: 1
1: 0
2: 2
3: 28
4: 354
Right 983217652 4:165017043-165017065 ACTTCCCTGACCAGAACCTCAGG 0: 1
1: 0
2: 1
3: 20
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983217647 Original CRISPR TAGTGAGGACAGATGGGACA GGG (reversed) Intergenic
901089043 1:6629424-6629446 TGGGGAGGACAGATGGGGCAGGG - Intronic
905149653 1:35917820-35917842 CAGGGAGGATAGATAGGACAAGG - Intronic
905364795 1:37444818-37444840 GAGTGTGGATTGATGGGACAAGG + Intergenic
905518856 1:38582145-38582167 AAGTGAGGGCAGATGGGTCCTGG + Intergenic
906259745 1:44377986-44378008 TAGAGAGAACAGATGGAAGATGG + Intergenic
907556745 1:55350682-55350704 TGGTGAGGGCTGATTGGACATGG + Intergenic
908897387 1:68915600-68915622 TAGTTAGGGCTGGTGGGACAGGG - Intergenic
908930534 1:69312229-69312251 CAGTGAGGACAGATGGGTCAGGG + Intergenic
910465699 1:87496907-87496929 TAGGGAGTACAGATGGCTCAGGG - Intergenic
911616637 1:100019752-100019774 TAGAGAAGACAGATATGACATGG - Intronic
912607568 1:111008131-111008153 CAGTGAGGAAGGATGGGTCAGGG - Intergenic
912720475 1:112015793-112015815 GAGTGAGGGTAGATGGGAGAAGG - Intergenic
912869444 1:113290698-113290720 TGGTGAGGGCAGGTGAGACAGGG - Intergenic
913181061 1:116321950-116321972 TAGAGAGGCCAGAGGGGCCATGG + Intergenic
914338566 1:146739051-146739073 TGGTGATGACAGTGGGGACAGGG + Intergenic
914404615 1:147358377-147358399 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
915844901 1:159252734-159252756 TGGTGAGGACATATGGGAATGGG - Intergenic
917453645 1:175167634-175167656 GTGAGAGGACAGATGGGAGAGGG + Intronic
917582366 1:176391813-176391835 CAGTGAGGAAGGATGGGTCAGGG + Intergenic
917796727 1:178538196-178538218 TGGTGAGAAGAGGTGGGACAGGG + Intronic
918168736 1:181975222-181975244 CAGTGAGGAAGGATGGGTCAGGG - Intergenic
918839241 1:189513284-189513306 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
920455613 1:206098924-206098946 TAGGGAGGAAAAATGGAACAAGG + Intronic
920593930 1:207249872-207249894 TAGACAGGACAGGTGGGATAGGG + Intergenic
921670371 1:217918061-217918083 CAGTGTGGACAGATGACACAAGG - Intergenic
921957604 1:221000448-221000470 GAATGAGGACAGATGGGGCAGGG - Intergenic
922051036 1:221990816-221990838 TGGTGAGGAAAGAATGGACATGG + Intergenic
922274922 1:224068600-224068622 TAATGAGGACAGACAGGCCAAGG + Intergenic
922518051 1:226223233-226223255 TGATGAGGACAGACGGGACTAGG + Intergenic
923077799 1:230625336-230625358 TGGGGAGGACAAATGGGAAAAGG - Intergenic
923942603 1:238844476-238844498 CAGTGAGGACAGATGGGTTAAGG + Intergenic
924629562 1:245724163-245724185 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
924955969 1:248927204-248927226 TTGTCATGAGAGATGGGACAGGG + Intergenic
1064182585 10:13131408-13131430 TGGTGACCACACATGGGACATGG + Intronic
1064194488 10:13234180-13234202 TAGTGAGTACAGGAGGGTCAAGG - Exonic
1065981999 10:30907472-30907494 CAGTGAGGACATATGGGCCTGGG + Intronic
1067525597 10:47036510-47036532 AAGTGATAACAGATGGGAAAAGG - Intergenic
1074833664 10:117268367-117268389 CACTGAGGACAGATGGTAGAAGG + Intronic
1075751826 10:124778664-124778686 CAGTGAGCAGAGATGGCACATGG + Intronic
1075959028 10:126550961-126550983 GGGTGAGGACAGAAGGGAGAGGG + Intronic
1076017306 10:127038371-127038393 TAGTGAGGACCTATGGGAAGAGG - Intronic
1076698446 10:132258018-132258040 CAGTGAGGGCACTTGGGACATGG - Intronic
1077142752 11:1031586-1031608 TGGTGAGGAGAGAAGGGCCAGGG - Exonic
1077159675 11:1107042-1107064 TAGAGAGGACAGGTGGCACCAGG - Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079426062 11:20343086-20343108 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1079800281 11:24860208-24860230 CAGTGAGGAAGGATGGGACAGGG - Intronic
1079935253 11:26608675-26608697 CAGTGAGGAGGGATGGGTCAGGG + Intronic
1080132998 11:28818339-28818361 GAGAGAGGACTGAAGGGACAAGG - Intergenic
1080164886 11:29224692-29224714 CAGTGAGGAAGGATGGGTCAGGG + Intergenic
1080283005 11:30580363-30580385 TAGGGAGGAAGGATGGCACATGG - Exonic
1080850699 11:36066978-36067000 AAGTTAGGACACCTGGGACATGG - Intronic
1081346556 11:41994528-41994550 TAGAGATGACAGCTGAGACATGG + Intergenic
1081886962 11:46506188-46506210 TAGAGTGGACAGAAGGGAGAAGG + Intronic
1083594312 11:63911772-63911794 CACTGAGGACAGAAGGGACTAGG - Exonic
1084473332 11:69375577-69375599 TTGTGAGGACAAACAGGACAAGG - Intergenic
1084933317 11:72574040-72574062 GAGAGAGGACAGATGGGAGGAGG - Intergenic
1087020638 11:93599389-93599411 CAGTGAGGTCAGAAGGGCCAGGG + Intergenic
1088363518 11:109016243-109016265 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1088363563 11:109016415-109016437 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1088363599 11:109016547-109016569 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1090231066 11:125104188-125104210 GAGTGAGGGGAGATGGGACCTGG + Intronic
1090321165 11:125844885-125844907 TGGTGAGGAAGGATGGGTCAGGG - Intergenic
1090817987 11:130315185-130315207 GAGGAAGGACAAATGGGACAGGG - Intergenic
1092777818 12:11959514-11959536 GGGTGAGGACAGAAGGGTCAGGG + Intergenic
1093216716 12:16370266-16370288 TTAGGAAGACAGATGGGACAAGG + Intronic
1093303304 12:17479526-17479548 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1093888091 12:24486546-24486568 AAGAGAGGCCAGAGGGGACAAGG - Intergenic
1094065709 12:26358850-26358872 TGGTGGGAACAGATTGGACATGG - Intronic
1094528210 12:31247355-31247377 GAGTTAGGAGAGATGGGATAAGG - Intergenic
1095973314 12:47920861-47920883 TAGTGAGAAGACATGGGAAAGGG - Intronic
1096514324 12:52147858-52147880 CAGTTTGGACAGATGGCACATGG - Intergenic
1096601166 12:52730706-52730728 TGATGGGCACAGATGGGACAAGG + Intergenic
1096783444 12:54003899-54003921 GAGAGAGAAGAGATGGGACATGG + Intronic
1097151103 12:56980557-56980579 TAGTGAGGTCAGATGTTGCAGGG - Intergenic
1097643117 12:62205559-62205581 CAGTGAGGAGGGATGGGTCAGGG + Intronic
1098201833 12:68064219-68064241 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1098439674 12:70504492-70504514 CAGTGAGGAAGGATGGGTCAGGG + Intergenic
1099148690 12:79080857-79080879 TTAAGATGACAGATGGGACAAGG + Intronic
1101187225 12:102292053-102292075 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1101540563 12:105661058-105661080 CAGTGAGGACAGAAGGGACTAGG - Intergenic
1101556786 12:105817418-105817440 TACTGAGGACAGAAAGGAGAGGG + Intergenic
1101809872 12:108098444-108098466 GAGTGTGGGCAGATGGGGCAGGG - Intergenic
1102760860 12:115383710-115383732 TACTGAGGGCAGATGGAGCAAGG + Intergenic
1104608349 12:130206091-130206113 CAGAGAGGACAGGTGGGCCAGGG + Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1108575432 13:51786375-51786397 GAGTGAAGACAGATGGGAGAGGG - Intronic
1108638160 13:52356777-52356799 TAGTGTGCCCAGAGGGGACATGG + Intergenic
1108708999 13:53015208-53015230 AAGTGAGAACAGGTGGGTCAAGG - Intergenic
1108815638 13:54287046-54287068 CAGTGAGGAGTGATGGGTCAGGG + Intergenic
1108957793 13:56182802-56182824 CAGTGAGGAGGGATGGGTCAAGG - Intergenic
1109097278 13:58134228-58134250 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1109307920 13:60661479-60661501 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1110458059 13:75712137-75712159 TAGTGAGGATAGCTGGGGGATGG + Intronic
1111773260 13:92625916-92625938 TAGTGAGGACACAATGAACAAGG - Intronic
1115344151 14:32324209-32324231 AATTGAGGAAAGATGGGAGATGG - Intergenic
1115419756 14:33180864-33180886 TAGTGATGACAGATTGAATAGGG + Intronic
1115928830 14:38467712-38467734 TAGTGAGGAGGGATGGGTCAGGG + Intergenic
1116428644 14:44820645-44820667 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1117064245 14:51993853-51993875 GAGAGAGGAAAGATGGGAAAGGG + Intronic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118972833 14:70651978-70652000 GAGTGGGGACAGTTGGGACCAGG + Intronic
1120369007 14:83607873-83607895 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1121085856 14:91145606-91145628 TGGTGGTGACAGTTGGGACAAGG - Intronic
1122287454 14:100660038-100660060 TGGAGGGGACAGAAGGGACAGGG + Intergenic
1123903740 15:24901846-24901868 TAATGAGGCGAGAAGGGACATGG + Intronic
1123969551 15:25494266-25494288 CAGAGAGGACAGATGTGTCATGG - Intergenic
1124046529 15:26155737-26155759 CAGTGAGGAGGGATGGGTCAAGG + Intergenic
1124149346 15:27163158-27163180 TACTGAGTAGAGATGAGACATGG - Intronic
1124196933 15:27639566-27639588 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1124650985 15:31473836-31473858 GAGTTAGCACAGATGGGAGAAGG - Intergenic
1124808918 15:32914684-32914706 TAGTGTGGACAGAAAGGATAGGG + Intronic
1125321108 15:38490015-38490037 TAGTGAGGAAGGAGGGTACATGG + Exonic
1126114899 15:45199464-45199486 TAGGGAGGATTGATGGGAGAGGG - Intronic
1126544763 15:49861304-49861326 GAGAGAGGACAGATATGACAAGG + Intronic
1126853052 15:52810025-52810047 GAGTGAGGAGAGTGGGGACAGGG + Intergenic
1127687703 15:61364848-61364870 CAGTGAGGAAGGATGGGTCAGGG + Intergenic
1131739694 15:95374951-95374973 TTGTGAGGCCAAATGAGACAAGG - Intergenic
1132191282 15:99863853-99863875 TAGTGAGGACACAGTGAACAAGG + Intergenic
1132315088 15:100883855-100883877 CAGTGATGACAGATGAGAGAGGG - Intronic
1132546627 16:536184-536206 CACTGAGGACAGCAGGGACAGGG - Intronic
1132898245 16:2238904-2238926 CTGTGAGCACAGCTGGGACAGGG + Intergenic
1133115356 16:3575430-3575452 GACTGAGGACAGGTGGGACTCGG + Intronic
1133121774 16:3612737-3612759 CAGTGAGAACAGATGAGGCAAGG + Intronic
1133830764 16:9321402-9321424 TTGTGAGCACAGGTGGGGCAAGG + Intergenic
1133872963 16:9706697-9706719 GAGGAAGGAAAGATGGGACAGGG - Intergenic
1137528717 16:49262488-49262510 TAGTGAGGTCAGTGAGGACATGG - Intergenic
1139045200 16:63049299-63049321 TGGAGGGGACAGATGGGACAGGG + Intergenic
1139995713 16:70978303-70978325 TGGTGATGACAGTGGGGACAGGG - Intronic
1140092980 16:71852421-71852443 TGGTGAGGAGAGATGGGGAAGGG - Exonic
1144132282 17:12258157-12258179 TTTGGAGGACAGATGGGCCACGG + Intergenic
1144849545 17:18237080-18237102 GGGTGAGGACAGATGGGAAGTGG + Intronic
1147831185 17:43299290-43299312 CAGCGAGAACACATGGGACACGG + Intergenic
1148913490 17:50955732-50955754 TACTCAGGGCAGCTGGGACAGGG + Intergenic
1149623074 17:58060587-58060609 TGCTGAGGACAGATGGGGCTGGG - Intergenic
1150190484 17:63232984-63233006 CAGTGAGGAGGGATGGGTCAGGG + Intronic
1151233992 17:72705247-72705269 TAGTGAAGACAGTGGGGAAAAGG + Intronic
1151417267 17:73974463-73974485 TAATGCGGTCAGGTGGGACAAGG + Intergenic
1155117508 18:22783992-22784014 CAGTGAGGAGCGATGGGTCAGGG + Intergenic
1158343492 18:56490926-56490948 TAGTCAGGATAGATCAGACAGGG + Intergenic
1158676979 18:59529198-59529220 CGGTGAGGAGAGATGGGTCAGGG + Intronic
1158693015 18:59678270-59678292 TGGTGAGGACAGAAGGACCAGGG + Intronic
1159084135 18:63768791-63768813 GAGGGAGGACAGATGGCAAAGGG - Intronic
1159646170 18:70921092-70921114 TGGTGAGGAGGGATGGGGCAGGG - Intergenic
1162297883 19:9826039-9826061 TTGTGAGGGCTGGTGGGACAAGG - Intronic
1163424709 19:17235131-17235153 TAGTGAGCACTGATAGCACAAGG - Intronic
1163804748 19:19388649-19388671 TTGTGAAGACAAAAGGGACAAGG + Intronic
1163949660 19:20571892-20571914 CAGTGAGGAGAGATGGGTCAGGG + Intronic
1165803771 19:38568113-38568135 TAGTGAGCAGGGAAGGGACAAGG - Intronic
1166904934 19:46101453-46101475 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1167108872 19:47447377-47447399 AGGTGAGGAGAGATGGGACGGGG - Intronic
1167687083 19:50963172-50963194 TGGTGAGGACCAATGGGACAGGG - Intronic
1168400101 19:56080708-56080730 TCATGACCACAGATGGGACATGG + Intergenic
925317230 2:2935843-2935865 TAGTGAGGTCGGATGGGACGGGG - Intergenic
928536787 2:32248924-32248946 TAGTTATGGCAGATGGAACAGGG - Intronic
928623311 2:33113579-33113601 TAGTGTGTACACATTGGACAGGG - Intronic
929928908 2:46237087-46237109 TCATGAGGACAGAGGGGACCTGG - Intergenic
931321809 2:61179536-61179558 TAGGGAAGAAAGATGGCACAAGG - Intronic
931560416 2:63555252-63555274 TAGTGAGGAGGGATGGGTCAGGG - Intronic
931816020 2:65901491-65901513 TAGTGAGAATAGAGGAGACAAGG + Intergenic
932103609 2:68923524-68923546 CGGTGGGGCCAGATGGGACAGGG - Intergenic
932105586 2:68938229-68938251 TAGAGAGGAAAGTTGAGACATGG + Intergenic
932874208 2:75433446-75433468 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
933692959 2:85194011-85194033 TAGTGTGAAAAGATGGGAGAGGG + Intronic
933893852 2:86792981-86793003 CAGTGAGGAGAGTTGAGACAGGG - Intronic
934134813 2:88985243-88985265 GAGGGAGGATAAATGGGACATGG - Intergenic
934235493 2:90228511-90228533 GAGGGAGGATAAATGGGACATGG + Intergenic
934810904 2:97275930-97275952 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
934826788 2:97432009-97432031 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
935062612 2:99621585-99621607 TGGTGGGGACAGAAGGCACAAGG + Intronic
935952648 2:108345098-108345120 TGGTGAGGAGAGATGGGTCCAGG + Intergenic
936521535 2:113214861-113214883 TGGTGAGGGCAGGTGGGAGAGGG + Intergenic
936786179 2:116096094-116096116 TAGTGAGGCCAAAGGTGACAGGG + Intergenic
937893957 2:126963347-126963369 CATTGAGGAAGGATGGGACAGGG + Intergenic
940167688 2:150793119-150793141 CAGTGAGAAAAGATGGGTCAGGG - Intergenic
940497630 2:154453538-154453560 TAGGGAAGGCAGATGGGAGAAGG - Exonic
941344343 2:164348655-164348677 TAGTGAGGAGATATGGGACCAGG + Intergenic
942376088 2:175339534-175339556 TAGTGAAGAGGGATGGGTCAGGG + Intergenic
943762396 2:191624015-191624037 AAATGAGGACAGAAGGGACCAGG - Intergenic
944385121 2:199155221-199155243 CAGTGAGGAAGGATGGGTCAGGG - Intergenic
945269314 2:207922903-207922925 TACTGAGGACAGGTGGGAAGAGG + Intronic
946596090 2:221307571-221307593 TAGTGATAACAGCTGGGCCAAGG - Intergenic
947041484 2:225926281-225926303 GAGTGATGAGAGATGGAACAAGG + Intergenic
948265592 2:236633222-236633244 TGGGGAGGACAGAGGGGACTCGG + Intergenic
1169298766 20:4423763-4423785 GCATGAGGACAGATGGGATAGGG + Intergenic
1169340943 20:4795790-4795812 GAGTGAGGAGAGACGGGGCAGGG - Intronic
1169951785 20:11052577-11052599 GATTGAGGAGAGATGGGATATGG + Intergenic
1169954112 20:11082351-11082373 TAATGAGTACAGGTGAGACAAGG + Intergenic
1171214393 20:23341743-23341765 CAGTAAGGACAGATGGGAATTGG - Intergenic
1171367977 20:24639388-24639410 CAGTGAGGACAGTAGGGTCAAGG + Intronic
1171943273 20:31351543-31351565 TGGTGAGGACACATGGGCCATGG - Intergenic
1172795166 20:37532037-37532059 TCTTGAGGACAGAGGGGAAAGGG - Intergenic
1172863238 20:38073733-38073755 TGGTAAGGACAGATGGGAGCCGG + Intronic
1174043356 20:47715431-47715453 ATGTGAGGACACAGGGGACAAGG - Intronic
1174114135 20:48215332-48215354 GAGTGTGTACAGGTGGGACAGGG - Intergenic
1174762106 20:53216357-53216379 GAGTGAGGACAAATGGGACTGGG + Intronic
1174973560 20:55305640-55305662 CAGTGAGGAGAGATGGGTCAGGG - Intergenic
1175185784 20:57178925-57178947 TCATGAGCACAGAAGGGACAAGG + Intronic
1175212848 20:57372328-57372350 AAGTGAAGCCAGATGGGACCAGG - Intronic
1176313181 21:5165465-5165487 TCGTCATGACAGATGGGATAGGG + Intergenic
1176520201 21:7818521-7818543 GAGTGAGCACAGAAGTGACAAGG + Exonic
1178654227 21:34448533-34448555 GAGTGAGCACAGAAGTGACAAGG + Intergenic
1179843867 21:44096565-44096587 TCGTCATGACAGATGGGATAGGG - Intronic
1181927743 22:26373937-26373959 AAGTAAGGAGAGATGGGAGAAGG - Intronic
1182276893 22:29195506-29195528 TAGTCAGCCCAGATGGGCCAAGG + Intergenic
1184335925 22:43853252-43853274 AAGTGAGTACACATGGGACGTGG - Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1184920460 22:47601780-47601802 TGGTGAGGAGAGCTGGGGCAGGG - Intergenic
1185022792 22:48389861-48389883 TGATGAGGAGAGAGGGGACATGG - Intergenic
949444132 3:4115254-4115276 TGGGGAGGACAGAAGGGAGATGG - Intronic
950908911 3:16567016-16567038 GAGTGAGGACAGATTGGTAATGG - Intergenic
951137248 3:19118341-19118363 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
952216997 3:31287796-31287818 TATTCAGGACACATGGGAGAGGG - Intergenic
952572296 3:34731926-34731948 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
952634020 3:35505511-35505533 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
952694585 3:36250365-36250387 CAGTGAGTAGGGATGGGACATGG - Intergenic
953929413 3:46998573-46998595 CAGTGGGGCCAGATGGGCCATGG + Intronic
954131713 3:48564424-48564446 TGGTGAGGACAGGTTGGAAACGG + Intronic
955012016 3:55026711-55026733 GAGAGATGACAGAGGGGACAAGG + Intronic
956314167 3:67915386-67915408 CAGTGTGGACGGATGGGACAGGG + Intergenic
958021179 3:87998100-87998122 TAGTGAGGACAGTGGAGAGAGGG - Intergenic
958080214 3:88737481-88737503 TAGAGAGGAAACCTGGGACAGGG + Intergenic
958481920 3:94654084-94654106 CAGTGAAGAAAGATGGGTCAGGG + Intergenic
959418362 3:106104283-106104305 CAGTGAGGAAGGATGGGTCAGGG + Intergenic
959883529 3:111473617-111473639 TGGTGAGGACAGATGGGTCAGGG + Intronic
959950569 3:112175676-112175698 TAGTGAGGAGAAATGGGATTCGG + Intronic
961049510 3:123734517-123734539 TAGAGAGGGCAGAGTGGACACGG - Intronic
961190854 3:124960215-124960237 TAGTGAGGTCATGTGGGCCAGGG - Intergenic
961563224 3:127745856-127745878 AAGTGGGGACAGAAGGCACAGGG + Intronic
962691946 3:137907713-137907735 CAGTGAGGAAGGATGGGTCAGGG - Intergenic
963924445 3:150936785-150936807 TAGTGAGGGGAAATGGCACAAGG - Intronic
964003942 3:151808185-151808207 CAGTGATGGCAGATGGGACCGGG - Intergenic
964295159 3:155225402-155225424 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
965663241 3:171064488-171064510 TAGTGTGGTCAGATAGGGCAAGG + Intronic
969553401 4:7888408-7888430 CAGTAAGGAGAGAGGGGACATGG + Intronic
971042249 4:22766742-22766764 TAGTGAGGACCAATGGAACTTGG - Intergenic
971363642 4:25958979-25959001 GGGTGAGGACAGTTGGGACAGGG + Intergenic
974499702 4:62684251-62684273 CAGTGAGGAGAGATGGCTCAGGG - Intergenic
975853301 4:78595808-78595830 TGGTGAGAACAGATGGGGCACGG + Exonic
976108199 4:81641894-81641916 GAGTGGGTAGAGATGGGACAAGG - Intronic
977970848 4:103212131-103212153 GAGCTAGGAAAGATGGGACAAGG + Intergenic
978327902 4:107579618-107579640 CAGTGAGGAGGGATGGGCCAGGG - Intergenic
978493996 4:109339834-109339856 AAGTGATGACAGATGGAAAATGG + Intergenic
978667648 4:111204977-111204999 CATTGACGACATATGGGACATGG - Intergenic
979668843 4:123341499-123341521 TAGAAGGAACAGATGGGACATGG + Intergenic
979775439 4:124583474-124583496 CAGTGAGGAAGGATGGGTCAAGG - Intergenic
979889998 4:126079899-126079921 TGATAAGGACAGATGGTACATGG + Intergenic
980392920 4:132169617-132169639 CACTGAGGAAAGATGGGTCAGGG + Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
981114705 4:140976305-140976327 TGGCAAGGAGAGATGGGACAAGG - Intronic
981682580 4:147416730-147416752 TAGTGATGACAGATGTACCATGG + Intergenic
983217647 4:165017021-165017043 TAGTGAGGACAGATGGGACAGGG - Intergenic
983774910 4:171594771-171594793 TGGTGAGGAGGGATGGGTCAGGG + Intergenic
984824705 4:183914127-183914149 AAGGGAGGAGGGATGGGACAAGG + Intronic
985173461 4:187176631-187176653 GAGTCAGGACAGAGGGGTCATGG + Intergenic
986628705 5:9748005-9748027 GAGTGAGGAAAGAATGGACATGG + Intergenic
987399830 5:17463730-17463752 CAGTGAGGAAGGATGGGTCAGGG + Intergenic
987988568 5:25181175-25181197 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
988788730 5:34587846-34587868 TAGTCAGAGCAGATGAGACAAGG - Intergenic
989276802 5:39598931-39598953 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
990678282 5:58213159-58213181 GAGTGAGTACAGAGGAGACATGG - Intergenic
991367701 5:65886393-65886415 TAGTGATGAGTGATGGGAGAAGG - Intergenic
992090122 5:73309755-73309777 TAGTGGGGACAGATCTGGCAAGG - Intergenic
993807919 5:92436219-92436241 CAGTGAGGAAGGATGGGTCAGGG - Intergenic
994350688 5:98742710-98742732 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
995960143 5:117829648-117829670 CAGTGAGGAAGGATGGGTCAGGG + Intergenic
996228681 5:121033630-121033652 TAGTGAGGTGGGATAGGACAAGG + Intergenic
996475442 5:123914602-123914624 AAGTGAGAACATATGGTACATGG - Intergenic
996482218 5:123988330-123988352 TAGTGAGGAGGGATGGATCAGGG + Intergenic
997357329 5:133271600-133271622 TACTGAGAACAGAAGGGACTTGG - Intronic
997716883 5:136049169-136049191 CAGAGAGGACAGCAGGGACAAGG + Intronic
998031046 5:138868344-138868366 CAGTGAGTACAGATGGGAAAAGG - Intronic
998630152 5:143889040-143889062 TAGAAGGGAAAGATGGGACATGG - Intergenic
999074495 5:148781411-148781433 TGGTGAGGAGATATGGGAAAGGG - Intergenic
999596905 5:153214947-153214969 TAGTGAGGAAGGATGGGTCAGGG - Intergenic
1000851189 5:166341841-166341863 CAGTGGGGACAGAAGAGACAAGG + Intergenic
1001656462 5:173354698-173354720 TAGTTAGGTAAGAGGGGACAGGG - Intergenic
1001795809 5:174501546-174501568 AAGTGAAGTCTGATGGGACAAGG - Intergenic
1002253901 5:177945170-177945192 TGCTGAGGACAGGTGGGGCAGGG + Intergenic
1002942604 6:1731466-1731488 TAGAGGGGACAGACGGGACTGGG + Intronic
1003687094 6:8315071-8315093 CAGTGAGGAAGGATGGGTCAGGG + Intergenic
1004179412 6:13367972-13367994 TAGTCAGGACAAGTGGGATAGGG - Intronic
1004809746 6:19247191-19247213 AAGTGGTGACAGATGGGACCTGG + Intergenic
1005467689 6:26131209-26131231 CAGAGAGTACAGATGGGATAGGG - Intronic
1005812677 6:29529175-29529197 CAGTGAGGACAGGTGGGAGCTGG - Intergenic
1005882619 6:30072459-30072481 GAGTGAGGAAAGAAGGGTCAAGG + Intronic
1005979338 6:30824431-30824453 GAGTGGGGACAGATGGGAGATGG + Intergenic
1007733624 6:43966793-43966815 CAGTAAGTAAAGATGGGACAGGG - Intergenic
1008834397 6:55808212-55808234 CAGTGAGGAGGGATGGGTCAAGG + Intronic
1009316706 6:62229238-62229260 CAGTGAGGAGGGATGGGCCAAGG + Intronic
1010198032 6:73259226-73259248 AAATGAGGAAAGATGGGACCTGG - Intronic
1010529193 6:76945740-76945762 AAGAGAGGACAGCAGGGACATGG + Intergenic
1012063077 6:94511964-94511986 CAGTGAGGAAGGATGGGTCACGG - Intergenic
1012642253 6:101633546-101633568 TAGTGAAGAAAAATGGCACATGG - Intronic
1013931978 6:115545391-115545413 CAGTGAAGAGAGATGGGCCAGGG - Intergenic
1014484746 6:121984960-121984982 CAGTGAGGAGTGATGGGTCAGGG + Intergenic
1015358198 6:132305278-132305300 CAGTGAGGAAGGATGGGTCAGGG - Intronic
1015579330 6:134706339-134706361 CAGTGAGGAGAGAAGGGATAAGG - Intergenic
1015660172 6:135566306-135566328 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1016165795 6:140941563-140941585 TGGTGAGGACAGTTGGGGGAAGG - Intergenic
1016768335 6:147819993-147820015 TGGAGAGGACAGAAGAGACAAGG + Intergenic
1017427020 6:154332665-154332687 AAGTCTGCACAGATGGGACAGGG - Intronic
1018266467 6:162029658-162029680 TAGTGGGAACAAATTGGACAGGG - Intronic
1018419019 6:163626080-163626102 GAGAGAGGACTGATGGGACCTGG + Intergenic
1019410668 7:905239-905261 TGGACAGGACAGAGGGGACATGG + Intronic
1019557799 7:1641281-1641303 GTGTGAGGACAGATGGGGCAGGG - Intergenic
1020345329 7:7156088-7156110 TAGTGAGGACTTATGGGGCCAGG + Intergenic
1020504195 7:8962825-8962847 TGGTGAGGGCAGATGGGAGGTGG - Intergenic
1021089967 7:16472058-16472080 AGGTGAGGACAGCAGGGACAGGG + Intronic
1022287922 7:28973333-28973355 GAGGGAGCACAGAAGGGACAAGG - Intergenic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023487138 7:40699346-40699368 TTGTGTGTGCAGATGGGACAAGG + Intronic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1024699291 7:51889759-51889781 TAGTGAGGACAGCTGAGCAATGG + Intergenic
1024883212 7:54112812-54112834 AAGACAGGACAGCTGGGACATGG + Intergenic
1026864563 7:73815441-73815463 TGGTGATGTTAGATGGGACAGGG + Intronic
1028644148 7:93076771-93076793 CAGTGAGGAGATATGGGTCAGGG - Intergenic
1029363709 7:100104179-100104201 AGCTGAGGACAGATGGGACTTGG + Intronic
1031396195 7:121277375-121277397 TAGGGATGAGAGATGGCACAGGG + Intronic
1033868242 7:145718453-145718475 TGGTGAGGAGGGATGGGTCAGGG + Intergenic
1034220297 7:149439205-149439227 GATTGAAGACAGATGGGAAAAGG - Intronic
1034632730 7:152543286-152543308 CAATGAGGACAGGTGGGGCATGG + Intergenic
1034972576 7:155428305-155428327 GGGTGAGGCCAGATGGGAAAAGG - Intergenic
1037249580 8:16877032-16877054 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1037287704 8:17318741-17318763 GAGTGAGGACAGATTGGAGTGGG - Intronic
1037473536 8:19235268-19235290 TGGGGAGGACAGATTGGACAAGG - Intergenic
1037522837 8:19697008-19697030 TGGTAAGGACAGATGGCAGAGGG + Intronic
1037922803 8:22819533-22819555 TAGGAAGGACAGCTGAGACATGG + Intronic
1038536387 8:28356222-28356244 TAGTGTGGGCCTATGGGACAAGG - Intronic
1039025389 8:33252750-33252772 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1039265158 8:35816105-35816127 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1039800197 8:40947809-40947831 TAGTTATGGCACATGGGACATGG - Intergenic
1039828500 8:41194787-41194809 AGGTGAGGACTGATGAGACAGGG - Intergenic
1040762991 8:50873808-50873830 CAGTGAGGAGGGATGGGTCAAGG + Intergenic
1041212822 8:55569753-55569775 AAGTGAAGTCTGATGGGACAAGG - Intergenic
1041606109 8:59784169-59784191 GAGTGAGAAAAGATGGGACGTGG - Intergenic
1041896707 8:62933051-62933073 GAGTGGGTACAGATGTGACAAGG - Intronic
1042759670 8:72257240-72257262 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1044495085 8:92867893-92867915 AAGTGAGCACAGATGTGAAATGG + Intergenic
1045154416 8:99451249-99451271 TAGAGAGGACAGATGGTTGAAGG - Intronic
1045699570 8:104850406-104850428 CAGTGAGGAGAAATGGGACCAGG + Intronic
1046556317 8:115777484-115777506 TTGTGAGGACAAATGGGACTTGG + Intronic
1046650619 8:116833163-116833185 TCTTGAGGACAGGTGAGACAGGG + Intronic
1049219177 8:141421113-141421135 GACGGAGGACAGAGGGGACAGGG - Intronic
1050618300 9:7426296-7426318 CAGTGAGGAAGGATGGGTCAAGG + Intergenic
1050943469 9:11488773-11488795 TAGTGAGGTCAACTTGGACAAGG + Intergenic
1051866635 9:21690858-21690880 AAGTGAAGTTAGATGGGACAAGG - Intergenic
1051987216 9:23105342-23105364 AAGGGGGGACAGATGGCACATGG + Intergenic
1052147444 9:25067639-25067661 TAGCGAGGGCTGATGGGGCATGG - Intergenic
1052716967 9:32128911-32128933 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1053481868 9:38422082-38422104 GAGTGAGGCCAGATGGCAGATGG - Intronic
1055818866 9:80238479-80238501 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1055997834 9:82180958-82180980 TAGTGGGGACTGAGGGGGCAGGG + Intergenic
1057006922 9:91568829-91568851 TTGTGAGCACAGAAGGGAGAGGG - Intronic
1057241654 9:93416891-93416913 CAGTGAGGAGAGATGGGTCAGGG + Intergenic
1057794554 9:98146099-98146121 TAGACAGGCCAGAGGGGACATGG - Intronic
1057797562 9:98169553-98169575 TCCTGAGGACAGAGGGGACCCGG - Intronic
1058095128 9:100851357-100851379 TAGTGGGGATAGATGGGATTGGG + Intergenic
1058591030 9:106565540-106565562 TAGTAAGGAAGGATGGGTCAGGG - Intergenic
1059282329 9:113145562-113145584 CAGAGAGAACAGAAGGGACAGGG + Intergenic
1059656913 9:116365646-116365668 TAGGGAGCAAAGATGAGACAAGG - Intronic
1060321112 9:122562069-122562091 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1060534133 9:124369763-124369785 GTGTGAGGAAAGGTGGGACAGGG - Intronic
1060551094 9:124485829-124485851 GAGCGAAGGCAGATGGGACAGGG - Intronic
1061073770 9:128328314-128328336 GAGGGAGGGAAGATGGGACAGGG - Intronic
1062025321 9:134337581-134337603 TACTGGAGACAGAAGGGACACGG + Intronic
1062067302 9:134535641-134535663 TGGGGAGGGCAGATGGGATAGGG + Intergenic
1188242940 X:27810902-27810924 AAGTGAGGACTGATGGGGCTAGG + Intronic
1189004352 X:36980550-36980572 AACTGAGGACAGGTGGGAAAGGG - Intergenic
1190472956 X:50800940-50800962 TAGTGAGCTCAGATGGGAAAGGG - Intronic
1192732867 X:73818760-73818782 TAGTGAGGAAAGGTCAGACAAGG - Intergenic
1193091106 X:77494569-77494591 TAGTGAGGAAGGATGGCTCAGGG - Intergenic
1194523143 X:94942996-94943018 CAGTGAGGACGGATGGGTCAGGG - Intergenic
1194851969 X:98881216-98881238 AAGTGAGGAAGGATGGGTCAGGG - Intergenic
1196582109 X:117391369-117391391 CAGTGAGGAGAGATGGGATTAGG - Intergenic
1197049551 X:122042416-122042438 CAGTGAGGAGGGATGGGTCAGGG + Intergenic
1198000166 X:132425984-132426006 GAGTGAGGAAAGTTGGCACATGG + Intronic
1198841355 X:140861115-140861137 CAGTGAGGAGGGATGGGTCAGGG - Intergenic
1199247074 X:145617785-145617807 TTGTGAGGAAAGATTGGAAATGG - Intergenic
1199308227 X:146292612-146292634 CAGTGAGGAAGGATGGGTCAGGG + Intergenic
1199874628 X:151920564-151920586 TAGGGAGTGCAGATGGGAAAGGG - Intronic
1201274544 Y:12285635-12285657 TAGTGATGGCAGATGGGGCCGGG + Intergenic
1202015784 Y:20405188-20405210 TAGTCTTAACAGATGGGACAAGG + Intergenic