ID: 983222692

View in Genome Browser
Species Human (GRCh38)
Location 4:165057821-165057843
Sequence GTAGAAACAAAGGCTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983222692_983222694 -3 Left 983222692 4:165057821-165057843 CCAAGCTCAGCCTTTGTTTCTAC No data
Right 983222694 4:165057841-165057863 TACTTCACAGTCTACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983222692 Original CRISPR GTAGAAACAAAGGCTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr