ID: 983222694

View in Genome Browser
Species Human (GRCh38)
Location 4:165057841-165057863
Sequence TACTTCACAGTCTACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983222690_983222694 26 Left 983222690 4:165057792-165057814 CCAAAGTGCTGGGATTACAGGCT 0: 6769
1: 222842
2: 272584
3: 187528
4: 184223
Right 983222694 4:165057841-165057863 TACTTCACAGTCTACAGTGTTGG No data
983222687_983222694 30 Left 983222687 4:165057788-165057810 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 983222694 4:165057841-165057863 TACTTCACAGTCTACAGTGTTGG No data
983222691_983222694 0 Left 983222691 4:165057818-165057840 CCACCAAGCTCAGCCTTTGTTTC No data
Right 983222694 4:165057841-165057863 TACTTCACAGTCTACAGTGTTGG No data
983222692_983222694 -3 Left 983222692 4:165057821-165057843 CCAAGCTCAGCCTTTGTTTCTAC No data
Right 983222694 4:165057841-165057863 TACTTCACAGTCTACAGTGTTGG No data
983222689_983222694 27 Left 983222689 4:165057791-165057813 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 983222694 4:165057841-165057863 TACTTCACAGTCTACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983222694 Original CRISPR TACTTCACAGTCTACAGTGT TGG Intergenic
No off target data available for this crispr