ID: 983237278

View in Genome Browser
Species Human (GRCh38)
Location 4:165193737-165193759
Sequence CTCCTATGTGTCCCTCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983237275_983237278 26 Left 983237275 4:165193688-165193710 CCTCTGCATATGATTACAGTTTT 0: 1
1: 0
2: 0
3: 13
4: 208
Right 983237278 4:165193737-165193759 CTCCTATGTGTCCCTCAAGAAGG 0: 1
1: 0
2: 2
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983237278 Original CRISPR CTCCTATGTGTCCCTCAAGA AGG Intronic
900897855 1:5496312-5496334 CTCCTCTGTGTCCCCCCAGCTGG + Intergenic
901196563 1:7443588-7443610 CTCCTCTGTGCCACTCAATATGG - Intronic
901508611 1:9702417-9702439 CTCCTCTGTGTGCCTCTAGATGG + Intronic
902280418 1:15370461-15370483 AACCTAAGTGTCCATCAAGAGGG - Intronic
904297655 1:29531899-29531921 ATCCTATGTGTCCCTAAACCTGG - Intergenic
908656515 1:66394556-66394578 CTCCCATGGGCCCCACAAGAAGG + Intergenic
909376460 1:74947722-74947744 CTCCTATGTGAGTCTCACGAGGG + Intergenic
911412281 1:97524734-97524756 CTGTAATGTGTCCATCAAGAAGG - Intronic
912434729 1:109653577-109653599 CACTTTTGTGTTCCTCAAGATGG - Intergenic
912746278 1:112248168-112248190 CTCCTCTGTCTCCCTCAAGTGGG - Intergenic
920058193 1:203207937-203207959 CTCTTAAGTGTCCCTGGAGAGGG - Intergenic
923110070 1:230883293-230883315 CTCCTGTGTTTGCCTCATGATGG + Intergenic
923176807 1:231474791-231474813 ACCCTATGTTTCCCCCAAGAGGG - Intergenic
1065257002 10:23880193-23880215 AACCTATGTGTCCATCAACAGGG + Intronic
1067531336 10:47076057-47076079 CTCCTATCTGCCCCTAATGAGGG + Intergenic
1067734002 10:48834907-48834929 CACCTATGTGGCCCTAAACATGG - Intronic
1068215731 10:53979581-53979603 CTCATATTCGTCTCTCAAGATGG + Intronic
1068618547 10:59150624-59150646 CTCCTATGTTTCCTTCAAGAAGG + Intergenic
1072033563 10:91543465-91543487 CTCCAGTATGTTCCTCAAGAGGG - Intergenic
1074980824 10:118618920-118618942 CTCCTTTCTCTCCCTGAAGATGG - Intergenic
1076167346 10:128293167-128293189 CTGCTCTGTGTGCCTCAGGACGG - Intergenic
1081474538 11:43413382-43413404 CTCCTATGTCTTCATAAAGAAGG - Intronic
1081685120 11:45036912-45036934 CTCCGATGTGCCCCTCCAGCTGG - Intergenic
1081862797 11:46343344-46343366 CACCTTTGTGTCCCTCATGATGG - Intronic
1090451600 11:126811083-126811105 CTCCTATTTGGCCCTCAGCAGGG - Intronic
1092331904 12:7592878-7592900 CTCCTATATGTTCCTGAAGCAGG + Intergenic
1094305272 12:29012162-29012184 CTCCTATGTTTGCTTCTAGAGGG - Intergenic
1098953442 12:76665176-76665198 CTCCCATGTGTCCCCAAACAAGG + Intergenic
1104576338 12:129969691-129969713 CTGCTCTGAGTTCCTCAAGAAGG + Intergenic
1111526346 13:89476266-89476288 CTCCTCTGTGCCCCACAAGCAGG + Intergenic
1118291534 14:64529203-64529225 CTACTATGGGCCCCTCAAAAAGG - Intronic
1118983710 14:70735434-70735456 GTCCTCTGTCTCTCTCAAGATGG - Intronic
1121226603 14:92325731-92325753 ATCCTATCAGTCCCTAAAGATGG + Intronic
1121782679 14:96631987-96632009 CCCCTCTGTGGCCCTCAAGCAGG + Intergenic
1121966317 14:98309751-98309773 CTTTCATCTGTCCCTCAAGATGG - Intergenic
1122817693 14:104321589-104321611 TTCCTAACTGTCCCCCAAGATGG - Intergenic
1127101659 15:55571968-55571990 TTCCTCTGTGTCCCTCAATAGGG + Intronic
1127951127 15:63807297-63807319 CTCCTATGTGTGCCTCTCAATGG - Intronic
1130225229 15:82052191-82052213 CTCCTCTGTCTCCCCCAAGCAGG - Intergenic
1130581356 15:85139860-85139882 CTGCTATCTCTGCCTCAAGATGG - Intergenic
1133612032 16:7442332-7442354 CTCCTTTGTGTGCCTAAGGAAGG - Intronic
1135992540 16:27226833-27226855 CTCCTGTGTGTCCCTGCAGAAGG - Exonic
1137271859 16:46907500-46907522 CTCCTGTGTGTCCCTCAGGTCGG - Intronic
1137665824 16:50248308-50248330 TTCCTTTGTGCCCATCAAGAAGG - Intronic
1139692710 16:68651209-68651231 CTCCTCCGTGTCCCTGCAGATGG - Intronic
1140838825 16:78820154-78820176 CTCCTATGTCTCCAGCAAGCAGG - Intronic
1141157141 16:81605260-81605282 CTGCCATGTGTCACCCAAGAAGG - Intronic
1142501919 17:337799-337821 CTCCTACGTGTGCCCCATGAGGG - Intronic
1146136579 17:30327191-30327213 CTGCCATGTCTCCCTTAAGAGGG + Intronic
1149377570 17:56061015-56061037 CTCCTTTTTGTACCTCTAGAAGG + Intergenic
1155222714 18:23699772-23699794 TTCCTAGCTGTCACTCAAGATGG - Intronic
1156524079 18:37749977-37749999 GTCCTATTTTTTCCTCAAGATGG - Intergenic
1165273075 19:34726840-34726862 CTGCTATTTGTCTCTCAAGGAGG + Intergenic
1167207480 19:48112348-48112370 CTCCTCAGTGACCCTCATGATGG - Intergenic
1168415132 19:56162904-56162926 CTCTTTTGTGTCACTCAAGATGG + Intergenic
1168708182 19:58481445-58481467 CCCCTTTGTGTCTCTCAAGCCGG - Intronic
926378971 2:12264998-12265020 CTCCTCTGTGGCCCTCATCAAGG + Intergenic
934487167 2:94725850-94725872 CTCCTCCATGTCCCTGAAGATGG - Intergenic
934488275 2:94738053-94738075 CTCCTCCATGTCCCTGAAGATGG + Intergenic
936042092 2:109157868-109157890 CTCCTAGGAGACCCTCAGGATGG + Intronic
936528843 2:113261008-113261030 CTCCTGTGTGTCCCTCAGAAAGG - Intronic
946072127 2:217043407-217043429 TTCCCATGTGTCTCTCAGGATGG + Intergenic
947015731 2:225617794-225617816 CTCCAATGTTTCCCTGCAGATGG - Intronic
947035531 2:225849731-225849753 ATTTTATGTGTCCCCCAAGAAGG + Intergenic
1168794882 20:604726-604748 AACCTCTGTATCCCTCAAGAGGG + Intronic
1169037130 20:2462709-2462731 CTCCTATGGGTCCCCCAATGGGG - Exonic
1170148130 20:13199722-13199744 TTCCTTTGTATCCCCCAAGAAGG - Intergenic
1177420078 21:20845013-20845035 CTCCCATTTGTCCTTCTAGATGG + Intergenic
1180998950 22:19979039-19979061 ATCCTATGAGCCCCTGAAGATGG - Exonic
1181407800 22:22697320-22697342 GTGCTCTGTGTCCCTCCAGAGGG + Intergenic
1181628320 22:24136121-24136143 CTCATGTGTGTCCTTCTAGAGGG + Intronic
1182961404 22:34478823-34478845 CTCCTACTTTTCCCTCATGAGGG + Intergenic
1184972199 22:48032111-48032133 ACCCTATGTGACCATCAAGAGGG - Intergenic
952683039 3:36117721-36117743 ATCCCATGTGTGCCTGAAGAGGG - Intergenic
955912161 3:63868402-63868424 CTCCTCTTTGGCCCGCAAGAAGG + Intronic
961961088 3:130855862-130855884 CTTCTATGTGTCCCTGCAGGAGG + Intronic
966699976 3:182838689-182838711 CTTCTATGAGTTCCTCAAGGAGG - Intronic
968699997 4:2051076-2051098 CTCCTATGTGGTACTGAAGATGG - Intergenic
973292262 4:48482720-48482742 CGGCGATGTGTCCCTAAAGAGGG - Intergenic
983237278 4:165193737-165193759 CTCCTATGTGTCCCTCAAGAAGG + Intronic
986490002 5:8279671-8279693 CTCCTATGCCTCACTCCAGACGG - Intergenic
987440837 5:17954425-17954447 ACCCAATGCGTCCCTCAAGAGGG + Intergenic
987444503 5:18001130-18001152 CACCCATGTGTCTCTCTAGATGG - Intergenic
992897065 5:81254627-81254649 CTTCTCTGTGGCCCTCCAGAGGG - Intronic
995853313 5:116569628-116569650 CTCCTCTGTGGCCCTCAAATTGG - Intronic
996045970 5:118873761-118873783 CTTCTCTGTGCCCCTCAAGATGG - Intronic
996663192 5:126027730-126027752 CTTCTTTGTGTCCCACAAGCAGG - Intergenic
1001278750 5:170370678-170370700 CTCCCATCTGTCCCTCAAGGAGG + Intronic
1004483020 6:16038936-16038958 CTACTATGTGTCATTCAATAGGG + Intergenic
1008063364 6:47022310-47022332 CTCTCATGTGTCACTAAAGAAGG + Intronic
1012929059 6:105297952-105297974 ATCTTCTGTGTCCCTCATGAAGG - Intronic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019526463 7:1482619-1482641 CTCCGATGTGTCCACCAGGAAGG + Exonic
1020530212 7:9323434-9323456 CTCCTCTCAGTTCCTCAAGATGG - Intergenic
1021530217 7:21635609-21635631 CTCATATGTCTTTCTCAAGAAGG - Intronic
1021598210 7:22339511-22339533 CTCTAATGTGTCCATCAGGATGG - Intronic
1022523673 7:31023685-31023707 CCCCTATATGTGCCTCAAGGAGG - Intergenic
1023832296 7:44046511-44046533 CTACTCTCTGTCCCTCATGAGGG + Intronic
1023995049 7:45154681-45154703 GTCCTCTGTGTCCCTGGAGAGGG + Intergenic
1025159047 7:56636974-56636996 CTTCTCTGTGTCCCCCAAGAAGG - Intergenic
1025727543 7:64081257-64081279 CTTCTCTGTGCCCCCCAAGAAGG + Intronic
1028905031 7:96143951-96143973 CTGGTATGTGTCCCTCCAGGTGG - Intronic
1029092926 7:98062536-98062558 CTCCTATGCCTCCCTCCATAAGG + Intergenic
1029735016 7:102460798-102460820 CTCCTAGGTGACCCTCACGCTGG - Intronic
1032630818 7:133649525-133649547 CTCATTTGTGTTCCTGAAGAAGG + Intronic
1037392014 8:18403159-18403181 CTCCCATTTTTCCCTCCAGAAGG - Intergenic
1037830180 8:22183475-22183497 TTCCTTTGTTTCCCTCTAGAGGG + Intronic
1040360352 8:46658898-46658920 CCCCTAGGTGGCCCCCAAGATGG - Intergenic
1041708013 8:60867138-60867160 CTCCTATTACTCCCTCAAAAGGG + Exonic
1043321745 8:78995518-78995540 AACCTATGTGTCCATCAACAGGG + Intergenic
1044466331 8:92511174-92511196 CTCCTATGTGGGCATGAAGAGGG - Intergenic
1044611478 8:94096430-94096452 CTCCTTTCTTTCCCTCCAGAAGG - Intergenic
1047208026 8:122819098-122819120 CTCCCATCTGGCCTTCAAGAAGG - Intronic
1049029876 8:140026523-140026545 TTCCTTTGTGTCCCTTAGGATGG - Intronic
1049664729 8:143837848-143837870 GTCCTGTGTGTCCCTGAGGAGGG - Intronic
1049848944 8:144820532-144820554 AGTCTGTGTGTCCCTCAAGAGGG - Intergenic
1052514516 9:29462778-29462800 CTACTCTGTGTCCCACAAGCAGG - Intergenic
1053586326 9:39463003-39463025 CTCCTATGAGGCAGTCAAGAGGG - Intergenic
1053669513 9:40346311-40346333 CTCCTCCATGTCCCTGAAGATGG - Intergenic
1053919309 9:42972553-42972575 CTCCTCCATGTCCCTGAAGATGG - Intergenic
1054380646 9:64486331-64486353 CTCCTCCATGTCCCTGAAGATGG - Intergenic
1054515101 9:66029980-66030002 CTCCTCCATGTCCCTGAAGATGG + Intergenic
1054579979 9:66902226-66902248 CTCCTATGAGGCAGTCAAGAGGG + Intronic
1056072039 9:82997452-82997474 CTCCTCTGTGTCCCACATGTGGG - Intronic
1058416366 9:104793119-104793141 CTCCTCTGTGACCCTCAACCAGG + Intronic
1059253924 9:112911631-112911653 CTCCAATGTGGACATCAAGAGGG - Intergenic
1061386324 9:130292037-130292059 CCCCTATGTTTCCCTCAAACTGG + Intronic
1192287746 X:69756116-69756138 CTCCTCTGTGTCACTCATGCTGG + Intronic
1192550562 X:72050061-72050083 CTCCTCTCTCTCCCTCCAGAAGG + Intergenic
1193221791 X:78935095-78935117 CTTCTCTGTGCCCCTCAAGCAGG + Intergenic
1194391296 X:93321130-93321152 ATCCTAAGTGTCCATCAACAGGG - Intergenic
1196138794 X:112238461-112238483 ATCCTAGGTGTCTTTCAAGAGGG - Intergenic
1196634066 X:117979444-117979466 TTCCTATGTGTCCTTCAAGAAGG + Intronic
1199375933 X:147109471-147109493 CTTCTCTGTGTCCTGCAAGAAGG - Intergenic