ID: 983241161

View in Genome Browser
Species Human (GRCh38)
Location 4:165234823-165234845
Sequence CTACTTTTATTGAGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 560}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983241161_983241164 -10 Left 983241161 4:165234823-165234845 CCTTTTTTTCTCAATAAAAGTAG 0: 1
1: 1
2: 3
3: 47
4: 560
Right 983241164 4:165234836-165234858 ATAAAAGTAGATAGGAGACTGGG No data
983241161_983241166 -2 Left 983241161 4:165234823-165234845 CCTTTTTTTCTCAATAAAAGTAG 0: 1
1: 1
2: 3
3: 47
4: 560
Right 983241166 4:165234844-165234866 AGATAGGAGACTGGGTACGGTGG 0: 1
1: 0
2: 6
3: 68
4: 667
983241161_983241167 25 Left 983241161 4:165234823-165234845 CCTTTTTTTCTCAATAAAAGTAG 0: 1
1: 1
2: 3
3: 47
4: 560
Right 983241167 4:165234871-165234893 TGCCTATAATCCCAGTACTTTGG 0: 436
1: 15073
2: 124993
3: 252797
4: 243094
983241161_983241170 29 Left 983241161 4:165234823-165234845 CCTTTTTTTCTCAATAAAAGTAG 0: 1
1: 1
2: 3
3: 47
4: 560
Right 983241170 4:165234875-165234897 TATAATCCCAGTACTTTGGGAGG 0: 971
1: 37224
2: 339828
3: 256481
4: 133929
983241161_983241168 26 Left 983241161 4:165234823-165234845 CCTTTTTTTCTCAATAAAAGTAG 0: 1
1: 1
2: 3
3: 47
4: 560
Right 983241168 4:165234872-165234894 GCCTATAATCCCAGTACTTTGGG 0: 718
1: 28348
2: 262543
3: 275614
4: 168700
983241161_983241165 -5 Left 983241161 4:165234823-165234845 CCTTTTTTTCTCAATAAAAGTAG 0: 1
1: 1
2: 3
3: 47
4: 560
Right 983241165 4:165234841-165234863 AGTAGATAGGAGACTGGGTACGG 0: 1
1: 1
2: 0
3: 26
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983241161 Original CRISPR CTACTTTTATTGAGAAAAAA AGG (reversed) Intronic
901436879 1:9251896-9251918 CTATTTTTGTTGAGAAAACCTGG + Intronic
903202405 1:21753160-21753182 CTACTTTTCTTTCCAAAAAATGG + Intronic
905076625 1:35277512-35277534 CTACTTTTAGTGATACTAAATGG + Intronic
907360710 1:53912236-53912258 CTACTATTATTTAGTGAAAATGG - Intergenic
907585855 1:55617245-55617267 CTACTTATTTTCAGAAAAAGGGG + Intergenic
907938317 1:59062734-59062756 TTTCTTTTATTGAGAAACTATGG - Intergenic
908187686 1:61668400-61668422 CTACATTTAATGAGGAAAAGGGG + Intergenic
908231923 1:62113726-62113748 CTCATTTAATTGAGATAAAAGGG - Intronic
909517371 1:76527248-76527270 ATACTTTTATTGTGAGAGAATGG + Intronic
909569920 1:77097758-77097780 TTACAATTATTGAGAATAAAGGG + Intronic
909891905 1:81017767-81017789 GTTATTTTATTCAGAAAAAAGGG - Intergenic
909957391 1:81796310-81796332 GTACTGTTAATGAGAAAACAAGG + Intronic
909970105 1:81973602-81973624 CAGCTTTTAGTAAGAAAAAAGGG + Intronic
910817673 1:91309922-91309944 CTACTATCATTTAAAAAAAAAGG + Intronic
910969617 1:92842743-92842765 CCAATTTTATTGACTAAAAATGG - Exonic
911028030 1:93455860-93455882 CAACTTATTTTGGGAAAAAAAGG - Intronic
911114307 1:94229317-94229339 ATACTTTTATTAAGTAAATAAGG + Intronic
911140504 1:94496561-94496583 CGACTTTTACTGTGACAAAATGG - Intronic
911333033 1:96547380-96547402 CCACTTTTATTTAGAAATGAAGG - Intergenic
911707343 1:101028753-101028775 ACACTCTTATTGAGAAATAACGG - Intergenic
911779221 1:101854469-101854491 CTACTTCAAAGGAGAAAAAATGG + Intronic
912340000 1:108904872-108904894 CTACTTTTAAAGAAATAAAAGGG + Intronic
912651929 1:111447845-111447867 CTGCTTTTAGTGAGAGAATATGG + Intronic
912827710 1:112921460-112921482 CACCTTTTTTTGAGCAAAAAAGG - Intronic
914046202 1:144095062-144095084 TTAGTTTTCTAGAGAAAAAAAGG - Intergenic
914131908 1:144865623-144865645 TTAGTTTTCTAGAGAAAAAAAGG + Intergenic
914230062 1:145757574-145757596 CTACTTTTAATGGAAAAGAAAGG + Intronic
914804752 1:150983821-150983843 CAACTTCTTTTGAGATAAAATGG + Intronic
915430503 1:155862577-155862599 CAACTTTTATTGTTAGAAAATGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917350155 1:174069010-174069032 ATACTTTTACCCAGAAAAAAAGG - Intergenic
917430831 1:174966931-174966953 ATAGTTTTATTAAGAAAAAAAGG - Intronic
918217186 1:182402146-182402168 GCACATTTATTAAGAAAAAAAGG + Intergenic
918227816 1:182502115-182502137 CTAGACTTATCGAGAAAAAAAGG - Intronic
918504663 1:185239037-185239059 CTACTATTTTTAAGATAAAAGGG - Intronic
919413390 1:197275359-197275381 CCACTTTTATTGGGTAAAATTGG + Intronic
920614720 1:207478876-207478898 CTACTTAGAGTGAAAAAAAAAGG + Intronic
921295545 1:213697924-213697946 CTAATTTTATTGATTTAAAAAGG - Intergenic
922141170 1:222888453-222888475 GTATTTTTATTGGGTAAAAAGGG + Intronic
924525415 1:244842835-244842857 CTTTTTTTATTAGGAAAAAAAGG - Intronic
1062852831 10:758998-759020 TTATTTTTATTAAAAAAAAAAGG + Intergenic
1063717585 10:8543820-8543842 CAACTTTCATTGAGAAACCAGGG - Intergenic
1064950983 10:20849990-20850012 CTATTTTCATTGAAAAAAAAAGG + Intronic
1066031562 10:31431569-31431591 CTACTTTTAGTGGGATATAAGGG + Intronic
1066491087 10:35895751-35895773 CTATTTTAATTGAGAACAAAGGG - Intergenic
1067005760 10:42660132-42660154 GTACATTTATTGAGAACAGATGG - Intergenic
1067215312 10:44297138-44297160 CTACTTGTACTAAGAGAAAAAGG - Intergenic
1068095180 10:52482597-52482619 CTGTATTTATTGAGAACAAAGGG + Intergenic
1068687391 10:59883016-59883038 CGACTTTAACTGAAAAAAAAAGG + Intronic
1069765112 10:70850789-70850811 CTACTTTTTGTGCAAAAAAAGGG + Intronic
1070183481 10:74037231-74037253 CTATTTTTATTTGGAAAAGATGG + Intronic
1071745016 10:88407531-88407553 CTAATTATCATGAGAAAAAAAGG + Intronic
1072394989 10:95030065-95030087 CAAATTTAATTGAAAAAAAAAGG - Intergenic
1073496680 10:103897970-103897992 CTATTTTTATATAAAAAAAATGG + Intronic
1073665553 10:105529314-105529336 CTCCTATTAAAGAGAAAAAATGG + Intergenic
1073841087 10:107500032-107500054 CTCCCTTTCTTGAGAAGAAAGGG + Intergenic
1074210860 10:111333720-111333742 GTTCTTTTATTCACAAAAAAAGG - Intergenic
1075283836 10:121165736-121165758 CTACTTTTAGGTAGAAAAAGGGG - Intergenic
1075880323 10:125845605-125845627 CTGCTCTTATTGGGAAGAAAGGG - Intronic
1075977359 10:126707243-126707265 CTACTTTGAATCAGACAAAAGGG - Intergenic
1077682672 11:4258615-4258637 CTAGTTTTATAGGTAAAAAAAGG + Intergenic
1078028548 11:7723893-7723915 CTACTGTTATTCAGAAGAACAGG + Intergenic
1078494868 11:11807072-11807094 TTACTTTTCTTGAGAGAAATGGG + Intergenic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1079560930 11:21818566-21818588 CTAATTTTATAGACTAAAAATGG - Intergenic
1079658578 11:23012937-23012959 CTTCTTTTATTCAGAGCAAAAGG + Intergenic
1079755559 11:24255739-24255761 ATAATTTTATTCAGAAAACATGG + Intergenic
1080018051 11:27527960-27527982 CTCCTTTTATTGAAAATCAAGGG - Intergenic
1080219520 11:29884891-29884913 CTACTATGATTTAGTAAAAATGG + Intergenic
1080355066 11:31433923-31433945 ATACTGTTATTGAGACACAAGGG - Intronic
1080747892 11:35125579-35125601 CTTCTTTTCTTGACAAAATAGGG - Intergenic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1081901896 11:46635763-46635785 CTACAGTTATTGAGCCAAAAAGG - Intronic
1082117201 11:48340566-48340588 TGACCTTTCTTGAGAAAAAAAGG - Intergenic
1082981629 11:59129193-59129215 ACATTTTTATTCAGAAAAAAAGG + Intergenic
1083809339 11:65094898-65094920 CCCCTATTATTGAAAAAAAAAGG - Intronic
1086270782 11:85063975-85063997 ATAATTTAGTTGAGAAAAAAGGG + Intronic
1086578546 11:88369272-88369294 ATATTTTTATTGAATAAAAATGG + Intergenic
1086926442 11:92645432-92645454 AAACTTTTATTAGGAAAAAAGGG - Intronic
1087166217 11:95006218-95006240 CTGCTTTCATTCAGAAAATATGG - Intergenic
1087456989 11:98398986-98399008 CTATTTTTATTAAGAAATCATGG - Intergenic
1087560688 11:99785756-99785778 CTACATCTATTGAGAAAATCAGG - Intronic
1087614080 11:100468711-100468733 TGACTTCTAATGAGAAAAAATGG - Intergenic
1087731666 11:101785093-101785115 CTGCATTTATTGAGATAATATGG + Intronic
1088001541 11:104887750-104887772 CTCCTATAATTTAGAAAAAAAGG + Intergenic
1088150614 11:106740312-106740334 CTACTCCCACTGAGAAAAAAAGG - Intronic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1088861353 11:113802685-113802707 CTACCTTTATTTTAAAAAAATGG + Intronic
1089235994 11:117025966-117025988 CCATTTGTATTGAAAAAAAATGG + Intronic
1090539469 11:127684877-127684899 TTAATTTTATAGAGAAAAATAGG + Intergenic
1090688024 11:129146956-129146978 AGATTATTATTGAGAAAAAAGGG + Intronic
1091107195 11:132933956-132933978 CTCCTGTGATGGAGAAAAAAAGG - Intronic
1091145436 11:133275196-133275218 CATATTTTTTTGAGAAAAAAAGG - Intronic
1091537570 12:1426882-1426904 ATACTTCTATGGAGAAAAAATGG - Intronic
1092343662 12:7697688-7697710 CTACTCTTATTGTTGAAAAAAGG - Intergenic
1092698212 12:11198055-11198077 CTTCTCTTATTGAGAGAAGACGG - Intergenic
1093697739 12:22181209-22181231 TTGCTTTTAGGGAGAAAAAATGG + Intronic
1094202457 12:27807842-27807864 CAACTTTTAATGAAAAAACACGG + Intergenic
1094415125 12:30208040-30208062 CTTTTTGTATTGAGAATAAAAGG + Intergenic
1094435576 12:30417597-30417619 ATGTTTTTAATGAGAAAAAATGG + Intergenic
1095245573 12:39917282-39917304 CAACATTTATTCAGAAGAAATGG + Intronic
1096269034 12:50149025-50149047 CTACTGTTTTAGAAAAAAAATGG - Intronic
1097061643 12:56289228-56289250 CCACTTTTTTTGTGAAAGAAAGG - Intronic
1097376451 12:58848868-58848890 CTACTTTTTTTGTGTAAATAAGG - Intergenic
1098131206 12:67352280-67352302 CTACGTTTATTCAGATAAATTGG - Intergenic
1098393943 12:69998319-69998341 CTACTCCAATTGAGAAAGAATGG - Intergenic
1099138505 12:78939840-78939862 CTACATTTATAGAGAAATTAGGG + Intronic
1099641748 12:85297540-85297562 TTACTTTTATAGAAAAGAAATGG + Intronic
1100118427 12:91339050-91339072 CTCCATTAATTGAGAAATAAAGG + Intergenic
1100228485 12:92583186-92583208 CAACTTTTCTTTAAAAAAAAAGG + Intergenic
1100318986 12:93472287-93472309 CTACTATTATTGAAAGTAAAGGG + Intronic
1100707817 12:97220619-97220641 GTGATTTTATTTAGAAAAAAAGG - Intergenic
1100708087 12:97223547-97223569 TGACTTTTATTTAGAAGAAAAGG + Intergenic
1101949251 12:109161953-109161975 CTTCATTTATTTACAAAAAAAGG - Intronic
1102846797 12:116193651-116193673 CTATTTTTGTTTAAAAAAAAAGG + Intronic
1104213891 12:126716807-126716829 CAACTTGTATTAAGAAAAAGTGG - Intergenic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1106278711 13:28242370-28242392 ATAATTTTGTTGAAAAAAAATGG - Intronic
1106290257 13:28354659-28354681 CTACTTTTTTTAAGCAAAAAAGG + Intronic
1106415526 13:29543217-29543239 CTACTTTCATGGGGGAAAAAAGG + Intronic
1106826687 13:33530153-33530175 TTATTTTTATTGTGAAATAAAGG + Intergenic
1106920171 13:34554698-34554720 CTATTTTGATAGAGGAAAAATGG - Intergenic
1107750754 13:43563631-43563653 CTAGATTAATTGAGAAAAACAGG + Intronic
1108463779 13:50694252-50694274 ATACTTTTACAGAGACAAAAAGG + Intronic
1108519812 13:51236162-51236184 TCACTCTTATTGAGAGAAAAGGG + Intronic
1108880314 13:55105668-55105690 ACAATTTTATTTAGAAAAAATGG + Intergenic
1109244788 13:59940635-59940657 CCATTTTAATTGGGAAAAAAAGG - Intronic
1109398725 13:61796041-61796063 CTACTTATTTTGTGGAAAAAAGG - Intergenic
1109495588 13:63167576-63167598 TTATTTCTTTTGAGAAAAAATGG + Intergenic
1109512205 13:63392599-63392621 ATAATTTTATTGAGATAAAATGG - Intergenic
1109864323 13:68242911-68242933 CTAGTTTCACTGAGAAAATATGG + Intergenic
1111052722 13:82906372-82906394 ACACTTTTACTGAGAAAAACAGG + Intergenic
1111059315 13:82992096-82992118 TTATTCTTAATGAGAAAAAAAGG - Intergenic
1111080515 13:83301113-83301135 TTACTTGTATTGAGAATAATGGG - Intergenic
1111797599 13:92942856-92942878 CTAGTCTGACTGAGAAAAAATGG - Intergenic
1112537148 13:100270572-100270594 CTACTTATTTAGAGAAAAAAAGG + Intronic
1112755535 13:102628623-102628645 CTACTACTATGAAGAAAAAAAGG - Intronic
1113063866 13:106354782-106354804 CTACTTTTATTGATACAACCTGG + Intergenic
1113298636 13:108990816-108990838 CTACATTTTTAGAGAAAAAATGG + Intronic
1113649122 13:112022647-112022669 ATACTTTTATTGCTAAAAAATGG - Intergenic
1113742279 13:112719736-112719758 CTCCTATTTTTGAGAAAAACCGG + Intronic
1114053456 14:18943573-18943595 CTACTTTTATTGTGATCAAGGGG + Intergenic
1114073051 14:19130963-19130985 CTACTTTGATTTAAAATAAATGG + Intergenic
1114089215 14:19269031-19269053 CTACTTTGATTTAAAATAAATGG - Intergenic
1114109103 14:19458352-19458374 CTACTTTTATTGTGATCAAGGGG - Intergenic
1115036363 14:28861533-28861555 CTATATTTATTGAGAGAAAAGGG - Intergenic
1115715133 14:36095039-36095061 CTCCTTTTGTTGAAAAATAAAGG - Intergenic
1115758526 14:36554350-36554372 CTTCTCTTATTGAGAAAATCAGG + Intergenic
1117400794 14:55356984-55357006 CTAGCTTTTTTGAGGAAAAACGG - Intronic
1117517478 14:56516315-56516337 CTACTTTTATTCTCACAAAATGG + Intronic
1117581386 14:57155027-57155049 TTATTATTATTGAGGAAAAAAGG - Intergenic
1117635012 14:57733542-57733564 ATACGTTAATTGAAAAAAAAAGG + Intronic
1118013487 14:61634480-61634502 CTGCTTTAATTTAGAAAATAAGG + Intronic
1118108140 14:62684350-62684372 CTTTTTTTTCTGAGAAAAAAAGG - Intergenic
1118131339 14:62967381-62967403 TTACTTATGTTTAGAAAAAAAGG - Intronic
1118814835 14:69303441-69303463 CTACTTTAATGGAGAAAGGATGG - Intronic
1119350907 14:73964699-73964721 CTACTTTTGTTGACAAAGATGGG + Exonic
1120011359 14:79419180-79419202 GTTCTTTCATTGAGATAAAAAGG + Intronic
1120096479 14:80394490-80394512 CATCTATTATTGAGAAACAAAGG - Intergenic
1120409087 14:84128932-84128954 CCACTTTTATTGCTAACAAATGG - Intergenic
1120533789 14:85667229-85667251 CTACTTTTAATGACAAAAAATGG - Intergenic
1120798661 14:88665521-88665543 ATACTTTAAATTAGAAAAAAGGG - Intronic
1121298738 14:92852318-92852340 ACACATTTATTGACAAAAAAGGG - Intergenic
1121756126 14:96403618-96403640 CTTCCTTTATTGAAAAACAAAGG - Intronic
1121911636 14:97797288-97797310 CTACTTTGATTTAGAACAAGTGG - Intergenic
1122060002 14:99130701-99130723 CCAATTTTATAGACAAAAAAAGG - Intergenic
1124417427 15:29484603-29484625 TGTCTTTTACTGAGAAAAAAGGG + Intronic
1124449845 15:29777888-29777910 CTTCTTTGAAGGAGAAAAAAAGG - Intronic
1126259742 15:46674681-46674703 CTACTTTTATTCTGTTAAAATGG - Intergenic
1126263376 15:46721912-46721934 CTAATTTTATTGGGAAAGACTGG + Intergenic
1126351975 15:47753218-47753240 CTAATTTAATTGAGAAACATAGG + Intronic
1126750643 15:51873434-51873456 CTACCTCTATTGAGAAACAAAGG + Intronic
1127530550 15:59839582-59839604 CTATTTTTATCTGGAAAAAAGGG + Intergenic
1127651161 15:61009214-61009236 CTACTTTTATAGGGAAAGAAAGG - Intronic
1127752250 15:62057444-62057466 CCAATTTTATTGAGAAATTAGGG + Intronic
1127805032 15:62511412-62511434 CAAGTATTTTTGAGAAAAAAAGG - Intronic
1128039569 15:64559213-64559235 CAACTTCTATTTAGAAAGAAAGG + Intronic
1129104023 15:73293160-73293182 CTACATATATATAGAAAAAAAGG - Intronic
1129624000 15:77177537-77177559 ATACTTTTATAAAGAAAAACGGG + Intronic
1131186369 15:90277960-90277982 CTATTTTTATAGGTAAAAAATGG - Exonic
1131949603 15:97666725-97666747 TTACTTTTGTGGAGAAAAAGAGG - Intergenic
1134322172 16:13174062-13174084 CTCATTTTATTGAGAATGAAGGG - Intronic
1137230892 16:46566164-46566186 TTATTTTTATTTAAAAAAAATGG + Intergenic
1137340805 16:47602281-47602303 CTACTTTTAAAGTGATAAAATGG + Intronic
1138835050 16:60424161-60424183 AAAATTTTATTTAGAAAAAAGGG - Intergenic
1140998962 16:80290012-80290034 CTACTTTTATTTGCAAAGAAGGG + Intergenic
1141588098 16:85048529-85048551 CTTTGTTTTTTGAGAAAAAAAGG - Intronic
1142842306 17:2643045-2643067 CTACTTTTATTTAAGAAAGAGGG - Intronic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1146556597 17:33830348-33830370 CCACTTTTATTTTGACAAAAAGG - Intronic
1148383978 17:47221445-47221467 CTGCTTTCACTGAGAAAAGAGGG + Intronic
1148739350 17:49883529-49883551 ATACTTTTATTGAGACTAAAAGG + Intergenic
1148970450 17:51476269-51476291 CTACTTTTTTTAATAAAAGAAGG - Intergenic
1149207246 17:54262740-54262762 CTATTTTTATTGTTATAAAAAGG + Intergenic
1149285788 17:55163101-55163123 CTACTTTTATGGAGAATTTATGG - Exonic
1149534025 17:57418171-57418193 CCACTTTTATTTACAAAAACAGG + Intronic
1149938825 17:60840926-60840948 TCACTTTTATTGAGACAATAGGG - Intronic
1150529010 17:65957517-65957539 TCACTTATATTCAGAAAAAAAGG - Intronic
1151040139 17:70850008-70850030 TTACTTTCATTGAAAAATAAAGG + Intergenic
1152992940 18:379092-379114 CTCCTTTTATTAGGAAAAGAAGG + Intronic
1154324802 18:13382175-13382197 CTACTTTGATTTTGGAAAAAAGG + Intronic
1155510684 18:26573454-26573476 CTACTTATAAAGAGACAAAAAGG + Intronic
1155569439 18:27175474-27175496 CTACATTTATTTAGAAAGTAGGG - Intronic
1155714608 18:28925950-28925972 CTAGTTTTGTTGAAAATAAAAGG + Intergenic
1156058260 18:33038061-33038083 ATACTTTTATTGAAAAAACTGGG - Intronic
1156730093 18:40183153-40183175 CTTCTTTTTTTTAAAAAAAAAGG - Intergenic
1156832143 18:41504404-41504426 TTACTTTTTTTGATAAACAAAGG + Intergenic
1158183965 18:54750172-54750194 TTAATTTAATTGATAAAAAATGG - Intronic
1158355180 18:56610570-56610592 ATAATTTTATTTAAAAAAAATGG - Intronic
1158530899 18:58259879-58259901 TTACTTTTATTGAACAACAAAGG + Intronic
1158726487 18:59977836-59977858 CCACTTTTAATGAAAAAGAAAGG - Intergenic
1159226103 18:65538071-65538093 CAAAATGTATTGAGAAAAAAAGG + Intergenic
1159362666 18:67425669-67425691 ATACCCTTATTGAGAAAGAATGG + Intergenic
1159401908 18:67949197-67949219 CTTCATTTAGTGAAAAAAAAAGG - Intergenic
1159804356 18:72938136-72938158 CTATTTTAAAGGAGAAAAAATGG - Intergenic
1163072466 19:14855739-14855761 CTACATTTATAAAGCAAAAAGGG - Intergenic
1166268973 19:41701890-41701912 CTCCTGTTAATGAGCAAAAAGGG + Intronic
1167407216 19:49319825-49319847 CTAATTCTATTGAGAAAAAAAGG - Intronic
1202685755 1_KI270712v1_random:48477-48499 TTAGTTTTCTAGAGAAAAAAAGG - Intergenic
925096290 2:1206723-1206745 CTGATTTTATAAAGAAAAAATGG + Intronic
925196527 2:1930385-1930407 CTGCATTTATTGAGCAAAAGAGG - Intronic
928283795 2:29971610-29971632 CAACATCTATTGAGAAAAATTGG + Intergenic
928387348 2:30881744-30881766 TTACTTTTATTTTTAAAAAATGG + Intergenic
928698577 2:33875747-33875769 AAACTTTTATTAAAAAAAAATGG - Intergenic
928782344 2:34839265-34839287 TGACTTTTATTGAAAAGAAAGGG + Intergenic
928862098 2:35871548-35871570 ATACTTTATATGAGAAAAAAAGG + Intergenic
929056763 2:37885002-37885024 CTCTTCTTAGTGAGAAAAAATGG - Intergenic
929310092 2:40413524-40413546 CCTCCTTTATTAAGAAAAAAGGG - Intronic
929332986 2:40706914-40706936 CTATTTTTATTTAAAAAATAAGG - Intergenic
929423294 2:41817336-41817358 TTACTTTTATAGAAAATAAAAGG + Intergenic
930223640 2:48770065-48770087 GTATGTTTTTTGAGAAAAAAAGG + Intronic
930423812 2:51187950-51187972 ATTCTTTTAATGAGGAAAAAAGG + Intergenic
930916779 2:56701094-56701116 CTACTTTAATTTAGAGTAAAGGG - Intergenic
931130822 2:59333635-59333657 CTACTTGTATTCTGAAAATAGGG - Intergenic
931132448 2:59351764-59351786 ATATTTTTATTTAAAAAAAAAGG - Intergenic
931235904 2:60412523-60412545 ATAGATTTATTGGGAAAAAAAGG - Intergenic
931686530 2:64798809-64798831 GTACTTTTTTTGGGGAAAAAAGG + Intergenic
932169482 2:69540429-69540451 CTATTTCTACTTAGAAAAAAAGG + Intronic
933047127 2:77553418-77553440 TTTCTTTTATTAAGAAAATAAGG + Intronic
933420187 2:82035148-82035170 ATTCTTTTGTTGGGAAAAAAAGG + Intergenic
934162718 2:89267747-89267769 CTGATTTCATTGAGAAGAAATGG - Intergenic
934204557 2:89914777-89914799 CTGATTTCATTGAGAAGAAATGG + Intergenic
934245969 2:90306347-90306369 TTAGTTTTCTAGAGAAAAAAAGG + Intergenic
934262777 2:91490688-91490710 TTAGTTTTCTAGAGAAAAAAAGG - Intergenic
935354209 2:102183508-102183530 CTAATTTGATAGACAAAAAAAGG + Intergenic
935459179 2:103308387-103308409 TTACTTGTATTGAGTAATAAAGG + Intergenic
936008259 2:108908782-108908804 ATCCTTTTTTTAAGAAAAAAAGG - Intronic
936803280 2:116293064-116293086 GAACTGTTATTCAGAAAAAAGGG - Intergenic
937001999 2:118476372-118476394 CTACTTTTCTTGGCCAAAAATGG + Intergenic
937149523 2:119676438-119676460 CTATTTTTTTTTAGAAAACAGGG + Intergenic
938574970 2:132595300-132595322 CTAATGTTATTCTGAAAAAAAGG - Intronic
938684690 2:133726756-133726778 CAACATTTATTAAAAAAAAATGG + Intergenic
939118096 2:138084565-138084587 CTTCCTTTGTTAAGAAAAAAAGG - Intergenic
939325794 2:140686560-140686582 ATACTTTTATTGATGAAAATAGG + Intronic
939354359 2:141082014-141082036 ATATTTTTATTGAGACAAAAAGG - Intronic
939624652 2:144461982-144462004 CTGCTTTTATTGGTAAAAATGGG - Intronic
939814668 2:146879320-146879342 CTACTTTGTTTGTGCAAAAAAGG + Intergenic
940377952 2:152978568-152978590 GTACTTCTAGTGAGGAAAAAAGG - Intergenic
941085800 2:161116200-161116222 CTGCTTATTTTGAGAAATAAAGG + Intergenic
941107016 2:161365517-161365539 ATATTTTTTTTTAGAAAAAAAGG - Intronic
941179291 2:162238615-162238637 CTATTCTTATGGAGAAAATATGG - Intronic
941449862 2:165646831-165646853 CTTTTTTTATTGGGAAAAAAAGG - Intronic
941941789 2:171046934-171046956 CTACTTTTGTTAAAAAAAATTGG + Intronic
943157111 2:184196801-184196823 CTATTTTTATTGAAAAACTATGG + Intergenic
943981776 2:194561160-194561182 CAAGTTTTGTTGAGAAAGAAAGG - Intergenic
944290670 2:198000994-198001016 CAAGTTTTATTGGAAAAAAATGG + Intronic
944384328 2:199147842-199147864 CTTCTTTTATTTAAAAAAATGGG - Intergenic
944719881 2:202412659-202412681 ATATTTTTATTGAGAAATATAGG - Intronic
944973576 2:205021908-205021930 TTACTTTTATTAGGAGAAAATGG + Intronic
945076597 2:206046154-206046176 CTAGTTTTATTGTAAAATAAAGG - Intronic
945096520 2:206224361-206224383 CTGTTTTAATTGAAAAAAAAAGG - Intergenic
945227531 2:207547488-207547510 CTCATTTTTTTAAGAAAAAAAGG - Intronic
945478680 2:210318645-210318667 TTACTTGTAAGGAGAAAAAAGGG + Intergenic
945854688 2:215054848-215054870 ATATTTTTATTCAGAGAAAATGG + Intronic
946486050 2:220101890-220101912 ACACTTTTAATGAGAAAAAAAGG + Intergenic
946579987 2:221118000-221118022 ATATTTTTATTGAAAAAAAAAGG + Intergenic
947390466 2:229634622-229634644 CTATTTTTTTTAAGAAAAAGTGG - Intronic
947469125 2:230384193-230384215 CAACTTTTATAATGAAAAAATGG + Intronic
947891103 2:233621280-233621302 ATAGTTTTAATGAGAAAAAGAGG + Intronic
947892699 2:233639898-233639920 ATAGTTTTAATGAGAAAAAGAGG + Intronic
948253963 2:236552562-236552584 ATAATTTTATTTGGAAAAAATGG + Intergenic
1168742778 20:208139-208161 CTACTTTAATTAGGAACAAATGG + Intergenic
1169331852 20:4722578-4722600 CTCCTTATATTAAAAAAAAAAGG - Intronic
1169558913 20:6778222-6778244 CTAATTTGATAGAGAAAAACAGG - Intronic
1169685820 20:8270121-8270143 TTATTTTTATTAAGAAGAAATGG - Intronic
1169776678 20:9262834-9262856 CTGCTTTAAGTGAGAAAAAGGGG + Intronic
1170270334 20:14520539-14520561 CTACTTTTATTGATCAGAATTGG + Intronic
1170357104 20:15505107-15505129 CTACTTTTCTGTGGAAAAAATGG - Intronic
1170503975 20:17004826-17004848 CTTCTCTTTTTGAGAAAGAAGGG - Intergenic
1170640796 20:18150900-18150922 GTGCTTTTATTGAGAAACATTGG + Exonic
1172945657 20:38686561-38686583 CTAATTTCATTGAGAAACACAGG + Intergenic
1173826947 20:46053860-46053882 CTACTTTTATAGAGAAGGGAGGG - Intronic
1174830643 20:53809082-53809104 CTCCATTCATTGAGCAAAAAAGG - Intergenic
1175046773 20:56113833-56113855 CTTCTTTTTTTGAGAATAAGGGG - Intergenic
1175161765 20:57013272-57013294 GAACTTTTATTGATAAACAAAGG - Intergenic
1177307506 21:19338658-19338680 TTACTTTTGTGGAGAAAAATGGG - Intergenic
1177616314 21:23525865-23525887 CTACTTTCATTGTGAAGACATGG + Intergenic
1177826896 21:26094213-26094235 TTACTTTTATTCAGAGATAAGGG + Intronic
1178084414 21:29098479-29098501 TTAAATTTCTTGAGAAAAAAAGG + Intronic
1178298837 21:31434128-31434150 CTATTTTTAAAGAAAAAAAAAGG + Intronic
1179137068 21:38688997-38689019 GTACTATTATTCAGAAAAACTGG + Intergenic
1179205545 21:39273752-39273774 TTATTTTTATTTAAAAAAAATGG - Intronic
1179332335 21:40415934-40415956 CTATTTTTAGGCAGAAAAAAAGG + Intronic
1180471925 22:15665954-15665976 CTACTTTTATTGTGATCAAGGGG + Intergenic
1180491492 22:15853317-15853339 CTACTTTGATTTAAAATAAATGG + Intergenic
1180604394 22:17046123-17046145 CTGCCTTTATTGACAAAGAAGGG - Intergenic
1180759786 22:18192098-18192120 CTAATTTTTTTAAGAAAGAAGGG - Intergenic
1180770098 22:18376399-18376421 CTAATTTTTTTAAGAAAGAAGGG - Intergenic
1180775882 22:18432602-18432624 CTAATTTTTTTAAGAAAGAAGGG + Intergenic
1180776232 22:18486267-18486289 CTAATTTTTTTAAGAAAGAAGGG + Intergenic
1180808956 22:18743638-18743660 CTAATTTTTTTAAGAAAGAAGGG + Intergenic
1180828038 22:18879354-18879376 CTAATTTTTTTAAGAAAGAAGGG - Intergenic
1181071882 22:20348614-20348636 CTAATTTTTTTAAGAAACAAGGG + Intergenic
1181194952 22:21177559-21177581 CTAATTTTTTTAAGAAACAAGGG + Intergenic
1181214492 22:21315215-21315237 CTAATTTTTTTAAGAAACAAGGG - Intergenic
1181794152 22:25291712-25291734 CTAGTTATATTGCCAAAAAAAGG + Intergenic
1185306212 22:50118431-50118453 ATATTATTATTGAGAAAAAGGGG + Intronic
1203231929 22_KI270731v1_random:117583-117605 CTAATTTTTTTAAGAAAGAAGGG - Intergenic
1203278137 22_KI270734v1_random:105353-105375 CTAATTTTTTTAAGAAAGAAGGG - Intergenic
949360843 3:3230656-3230678 CTTCTTTTATTGGGAATAATAGG - Intergenic
950470706 3:13184492-13184514 CTACCTTTATGGAGAAAGAATGG + Intergenic
951235086 3:20225655-20225677 CTACTTTTGTTGAAAAAGTATGG - Intergenic
951258391 3:20478373-20478395 CTGGTTTTATTGAGAATAAAAGG + Intergenic
951696624 3:25451574-25451596 ATTATTTTATTGAGAAAAAGAGG + Intronic
952008225 3:28867588-28867610 CTCCTTTTGTTTAGAATAAAAGG - Intergenic
952124623 3:30286121-30286143 CTACTTTTACTGGCAAACAATGG + Intergenic
953693953 3:45143432-45143454 CTATTTTTAATAAGAAAAACTGG + Intronic
954596931 3:51833358-51833380 TGACTTTTAATGAGAAACAATGG - Intergenic
955028796 3:55196582-55196604 GTTCTCTTATTGAGAAAAAAAGG - Intergenic
955859378 3:63311357-63311379 CTACTTTTATAGATAAAAGCTGG - Intronic
955918858 3:63933666-63933688 CTACTTTTCTTTTGCAAAAAAGG + Intronic
956109599 3:65857112-65857134 CAACTGCTATTGAGAAAGAAGGG - Intronic
956514712 3:70034019-70034041 CTATATTTAGGGAGAAAAAATGG + Intergenic
957123591 3:76128857-76128879 CTCCTTTTATTGTGAAGAAAAGG - Intronic
957366783 3:79235120-79235142 CTAATTATATTGAGAATAAAGGG + Intronic
957377699 3:79380139-79380161 CAACTTTCATTGAGAATAAAAGG + Intronic
957438828 3:80216144-80216166 CTAATTTTCTGTAGAAAAAAAGG - Intergenic
957550850 3:81702019-81702041 CAACTATTATTAGGAAAAAACGG + Intronic
957720840 3:83996437-83996459 ATACTTTTGCTGAGAAATAAAGG - Intergenic
958544455 3:95524182-95524204 TTAATTTTATTGAGATATAATGG + Intergenic
958775096 3:98472609-98472631 GTACTTTTATGGAGTAAAATTGG + Intergenic
958801110 3:98756945-98756967 TTAATTCTATTGAGAAAACAAGG - Intronic
959123922 3:102267174-102267196 GTACTGTGATTGAGAAAAAGTGG + Intronic
959148540 3:102579841-102579863 CTCATTTTATAGATAAAAAAGGG - Intergenic
959420612 3:106123964-106123986 CTATTTTTAATTATAAAAAAAGG - Intergenic
959780382 3:110225158-110225180 CTTCCTTTATTCTGAAAAAAAGG - Intergenic
960251180 3:115455764-115455786 CTATTTTAATTGAGAAAATAAGG - Intergenic
961003470 3:123389444-123389466 CTACTGGTATTGGGAAAAAGTGG - Intronic
961090740 3:124109605-124109627 CTGGCTTTATTGAGATAAAATGG + Intronic
961244291 3:125437904-125437926 CTACTTTTTATAGGAAAAAAAGG + Intergenic
962507778 3:136065641-136065663 CTAATTTGATTAAGAAAAAAGGG + Intronic
963315940 3:143758825-143758847 CTACATTTAATGACAGAAAAGGG + Intronic
963332799 3:143934256-143934278 GTACTGTTATTAAGAATAAATGG - Intergenic
963396878 3:144746067-144746089 CTATTTTCATTGAGATTAAAAGG + Intergenic
963523696 3:146389251-146389273 TTATTTTTCTTGAGAAAAAGTGG + Intergenic
963612816 3:147493598-147493620 CTAATATTATTCAGAGAAAAGGG - Intronic
963811482 3:149781125-149781147 CTACTTTTACTGTTTAAAAAGGG + Intronic
964455053 3:156854851-156854873 CTACATATATTAAGAAAATAAGG - Intronic
964722107 3:159777962-159777984 TCACTTTTATTTAGAAAAACAGG + Intronic
964905523 3:161715027-161715049 CTTCCTTTGGTGAGAAAAAAAGG + Intergenic
964946552 3:162232488-162232510 TGACTTTTATTGAGGAAAACAGG + Intergenic
966168783 3:177053293-177053315 CAAACTTTATTGAGAAAAACAGG + Intronic
966612810 3:181884712-181884734 ATAATTTTAAAGAGAAAAAATGG - Intergenic
966990795 3:185227971-185227993 CTACATTTATAAAGAAAATAAGG + Intronic
967078880 3:186030458-186030480 CTAACTTTATCAAGAAAAAAAGG - Intergenic
967258318 3:187616255-187616277 CTACTCTGATGGAGAGAAAATGG + Intergenic
967986864 3:195101788-195101810 CTATCTCTATTGAAAAAAAAAGG + Intronic
968560872 4:1281144-1281166 CTACTTTTACTGACAAGTAAGGG - Intergenic
968944595 4:3656961-3656983 CTTCATTTATTGCAAAAAAAAGG + Intergenic
969877992 4:10150130-10150152 CCACATTCATTGAGTAAAAATGG - Intergenic
969955064 4:10880770-10880792 AAACATTTATTGAGAACAAATGG + Intergenic
970126348 4:12816786-12816808 CAACATTTATGGACAAAAAAAGG - Intergenic
970459655 4:16260580-16260602 TTACTGTTAGTGAGAAGAAATGG + Intergenic
970698044 4:18700698-18700720 CTTCTTCTTTTGAGAAATAAAGG + Intergenic
970905833 4:21215260-21215282 CTTCATTAATTGAAAAAAAAAGG - Intronic
970914530 4:21317397-21317419 CTCCTTATTTTGAGAAAAAAAGG + Intronic
971094451 4:23384728-23384750 ATACTGTCATTGAGAAAATATGG + Intergenic
971138170 4:23892995-23893017 TTTCTATTGTTGAGAAAAAATGG - Intronic
971916762 4:32880308-32880330 ATATTTTTATTCAGATAAAATGG + Intergenic
972087284 4:35234767-35234789 TAACTTTTATTAAAAAAAAAAGG - Intergenic
973029301 4:45315433-45315455 CTCTTTTTATTTAGAAGAAAGGG + Intergenic
973294943 4:48508146-48508168 CTAATTTTATTTACAAAAATAGG + Intronic
974712804 4:65623140-65623162 CCACTTTTATTAAGAAAAGATGG + Intronic
974757936 4:66236804-66236826 TTACTTTTATTTAAGAAAAATGG - Intergenic
975237680 4:72019110-72019132 CTACTTTAATTTAGATGAAATGG - Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
977068041 4:92344288-92344310 ATACTTTTATTTACAAATAATGG - Intronic
977091939 4:92688560-92688582 CTACATTCAGTGACAAAAAAAGG - Intronic
977234106 4:94486483-94486505 GTACTTCTAGTAAGAAAAAAGGG - Intronic
977390113 4:96398057-96398079 AAACTTTTATTGAGAACACATGG - Intergenic
977621375 4:99141514-99141536 TTTATTTTATTCAGAAAAAATGG - Intronic
977647983 4:99436092-99436114 CAACTTATATTAAGAAATAATGG - Intergenic
977815821 4:101412639-101412661 CAACTTTTAAGGAGAAAACAAGG + Intronic
977842311 4:101723356-101723378 CTACTTTCATTTAGAAATAAAGG + Intronic
977889607 4:102293809-102293831 CAACTTTTAGTGAAAAAACAAGG + Intronic
977978460 4:103294846-103294868 CAACTTTTAGTGGGAAAAAAGGG - Intergenic
978714790 4:111828551-111828573 CTAGTTTTATGGAGAATACAGGG + Intergenic
978753689 4:112281419-112281441 CCACTGTTAGAGAGAAAAAATGG + Intronic
978889618 4:113808613-113808635 CTGCTTTTAGGGAAAAAAAAGGG - Intergenic
979210957 4:118102076-118102098 GTTTATTTATTGAGAAAAAATGG + Intronic
979781191 4:124652980-124653002 CTACTTCTAATGAGCAGAAAAGG - Intergenic
979991205 4:127377862-127377884 ATACATTTTTTGAAAAAAAATGG - Intergenic
980867622 4:138571918-138571940 CTACTTCTACTTATAAAAAAAGG - Intergenic
981069267 4:140517781-140517803 ATACTTTTAGTGAGAAAACAAGG - Intergenic
981741477 4:148006658-148006680 GTACTTTTAAGGGGAAAAAAGGG + Intronic
981867484 4:149441523-149441545 CTACTTTTCATGAAAAAAGAAGG - Intergenic
982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG + Intergenic
982166554 4:152618553-152618575 CAAGTTTTATTAAGAAAAAGAGG - Intergenic
982285628 4:153731088-153731110 CTTCATATATTGAGAAAATATGG - Intronic
982424693 4:155244918-155244940 GTTCTTTTAATGAGAGAAAAAGG + Intergenic
982550370 4:156790651-156790673 ATATTTTTGTTGAGAAAAATTGG - Intronic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
983461765 4:168033577-168033599 CTCCATGTCTTGAGAAAAAAAGG - Intergenic
984036191 4:174671010-174671032 ATACATTAATTTAGAAAAAAGGG - Intronic
984136784 4:175951271-175951293 CTACTTTTAGTAGGAAAAATGGG + Intronic
984189355 4:176586789-176586811 ATCCTTTTTTTGGGAAAAAAAGG + Intergenic
984226745 4:177044412-177044434 GTTCTTTTAGTGAGAAAGAAAGG - Intergenic
984549182 4:181140485-181140507 CTACTTAAAAAGAGAAAAAATGG - Intergenic
985470206 5:37218-37240 CTATGTTTATTGTGAATAAAGGG - Intergenic
985945738 5:3181518-3181540 CTACTTTTATTCAAAATTAAGGG + Intergenic
986320022 5:6623118-6623140 CTAATTATATTAAGAAAAAATGG + Intronic
987126926 5:14821888-14821910 TTATTTTTATGGAAAAAAAAAGG - Intronic
987394714 5:17412287-17412309 CTTACTTTATTGAGATAAAAAGG - Intergenic
987417821 5:17682656-17682678 ACATTTTTATGGAGAAAAAAAGG + Intergenic
987629914 5:20456857-20456879 CTACTTTTATTGTAAATTAAAGG + Intronic
988188249 5:27896429-27896451 TTACTTTTTTTAAAAAAAAAGGG - Intergenic
988292753 5:29310806-29310828 CTATTTTTTTTGAGAAAGAGTGG - Intergenic
988385762 5:30562770-30562792 CTACTTTTATTTTCAATAAATGG + Intergenic
988446398 5:31290661-31290683 GTTCTTTTCTTGGGAAAAAAAGG - Intronic
988688251 5:33547014-33547036 GTTCTTTTATTGAGCAGAAAAGG - Intronic
989018942 5:36977454-36977476 TTAATGTTATTGAAAAAAAATGG + Intronic
989813691 5:45709986-45710008 TTATTTTTTTTGAAAAAAAAAGG + Intergenic
990738878 5:58892303-58892325 CTTGTTTTATTGAAAAATAAAGG - Intergenic
990934577 5:61134227-61134249 CTTATTTTATAAAGAAAAAATGG + Intronic
991192023 5:63885578-63885600 TTACTTTTATTTATAAAAGATGG + Intergenic
991376057 5:65968491-65968513 CTACATTTATTGAGTAAAGAAGG + Intronic
992130780 5:73690818-73690840 CCATTTTAATTGAGGAAAAATGG - Intronic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993269881 5:85782333-85782355 GGACATTTATTGACAAAAAAGGG - Intergenic
993307725 5:86291711-86291733 CTGCTTTTTTTGAAATAAAAGGG + Intergenic
993387229 5:87274432-87274454 CCATTTTTATTAAGAAACAATGG - Intronic
994074764 5:95638300-95638322 CAAGTAGTATTGAGAAAAAAAGG - Intergenic
994492633 5:100466000-100466022 ATACTTTTCTTGACAAAAAGAGG - Intergenic
994568180 5:101481423-101481445 CTATGTTTATAGAGAGAAAATGG + Intergenic
994823920 5:104688227-104688249 CTAAATATATTGAGCAAAAATGG - Intergenic
994930476 5:106176567-106176589 CTGCCTTTTTTGAAAAAAAATGG - Intergenic
995657704 5:114445308-114445330 CTCCGTTTACTAAGAAAAAAGGG + Intronic
995865936 5:116690717-116690739 CTTGTTTTTTTGAGAATAAATGG - Intergenic
996191615 5:120550235-120550257 CAACATTTTTTGAGAAATAATGG + Intronic
996457963 5:123706925-123706947 TTACTTTTTTTGAGAAAAAATGG + Intergenic
998314363 5:141167884-141167906 CAAGGTTTATTGAGAAAAAAGGG + Intergenic
998336925 5:141381478-141381500 CTAGTGTAATTGAGAAAACAGGG - Intronic
999035107 5:148339938-148339960 ATAATTTTAGGGAGAAAAAAAGG + Intergenic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
999780174 5:154842829-154842851 CTATTTTTTTTTAAAAAAAAAGG - Intronic
999890731 5:155976222-155976244 CTATTTTTATAGAGACAAAATGG - Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1000026707 5:157364795-157364817 CTTCTTTCATTGAGAAGAATTGG - Intronic
1000473702 5:161678461-161678483 GTACTGTTAAGGAGAAAAAAAGG - Intronic
1000542834 5:162561762-162561784 GTAATTTTATTTAGAAAATAAGG - Intergenic
1000726989 5:164783789-164783811 CTACTTTAGATGAAAAAAAATGG + Intergenic
1001583347 5:172815655-172815677 GTACTTTTATAACGAAAAAAAGG + Intergenic
1001631517 5:173178986-173179008 TAAATTCTATTGAGAAAAAAAGG + Intergenic
1002379215 5:178813503-178813525 CTACTTGTATTGTGAGTAAAGGG - Intergenic
1003302341 6:4894813-4894835 CGACTTTTGTGGACAAAAAAGGG - Intronic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1003832418 6:10027977-10027999 CCAATTTTATTGTGGAAAAATGG - Intronic
1005046141 6:21644462-21644484 TTACTTATATGGGGAAAAAAAGG - Intergenic
1006132968 6:31879773-31879795 CAACATTTATTGAGAACAAAAGG + Exonic
1006525823 6:34604004-34604026 CTGCTTAGATTAAGAAAAAAAGG + Intronic
1007014998 6:38456678-38456700 CAACTTTTTTTAAGAAAAGAGGG - Intronic
1007368842 6:41413166-41413188 CTCCTTTTCTTGAAAAAAAGGGG - Intergenic
1007910676 6:45511185-45511207 CTGCTTATATACAGAAAAAAAGG - Intronic
1008308162 6:49931424-49931446 CTACTTTTATTGAGAAAAGATGG + Intergenic
1008477599 6:51949209-51949231 CTAAATTTTTTAAGAAAAAATGG - Intronic
1008598773 6:53068342-53068364 AAACATTTATTGAGAATAAAAGG + Intronic
1008622176 6:53281386-53281408 GTATTTTTAATGAGAAAACAGGG + Intronic
1009820372 6:68792409-68792431 CTACTGTTATTTAGCAATAATGG - Intronic
1009896127 6:69752285-69752307 CTACTTCTATTATGAAGAAAAGG - Exonic
1010101628 6:72116194-72116216 CAACTTTTATACAGAAAAATAGG + Intronic
1010355448 6:74927373-74927395 ATCCCTTTATTGAGCAAAAATGG + Intergenic
1010377620 6:75190482-75190504 CTACTTTTAGTGAACAAAGAGGG + Intronic
1010793890 6:80096655-80096677 ATACTTTTATGAAGACAAAAGGG - Intergenic
1010863558 6:80943689-80943711 CTACTTTAATTGCAAATAAAAGG + Intergenic
1011091176 6:83601988-83602010 CTACTTTTTTTGAGAAACATGGG - Intronic
1011139650 6:84139133-84139155 CTACTTTTAGGCAGAAAAAGAGG - Intronic
1011429166 6:87266925-87266947 CTACTATTCTTGAAAAAATAGGG + Intergenic
1011587475 6:88942293-88942315 ATACTGTCATTCAGAAAAAAAGG - Intronic
1011854547 6:91673001-91673023 CAAATATTATTGAGAAAAATCGG - Intergenic
1012411103 6:98958066-98958088 ATACTGTTATTGTCAAAAAATGG - Intergenic
1013019366 6:106197351-106197373 CTACCTTTTTTGAAAACAAAAGG - Intronic
1013318646 6:108965462-108965484 CTATTGTAATTGAGAAAATACGG + Intronic
1013400590 6:109792155-109792177 GTAATTTTATTTACAAAAAAAGG - Intronic
1013698653 6:112734970-112734992 TTACTTTTATCAATAAAAAATGG - Intergenic
1013835367 6:114328781-114328803 CTACTTTGAATGATAAAAGATGG + Intronic
1013922845 6:115429827-115429849 CTGCATCTATTGAGAATAAAGGG - Intergenic
1014727896 6:124994965-124994987 CTACTAATATTGTGTAAAAATGG + Intronic
1014816118 6:125937696-125937718 CTACATATATTGATATAAAATGG - Intergenic
1016249607 6:142024717-142024739 CTGTTTGTTTTGAGAAAAAATGG - Intergenic
1016930452 6:149402191-149402213 CTAGATAAATTGAGAAAAAAAGG + Intronic
1018471900 6:164105024-164105046 TAATTTTTATTGAAAAAAAATGG + Intergenic
1018605284 6:165591095-165591117 GTATTTTTATTGGGAAAAAAAGG + Intronic
1020550093 7:9593394-9593416 TTACTTTAATTGTGAAAATAGGG + Intergenic
1021010003 7:15450540-15450562 ATACTTTTATGTAGAAAGAAAGG + Intronic
1021026910 7:15679762-15679784 CTAATTCTATTGATAAAACAAGG + Intronic
1021359784 7:19697454-19697476 CTGCTTTCATTGAGAAAATGTGG - Exonic
1022147852 7:27564381-27564403 CTACATATATTAAGAAAAAAAGG - Intronic
1022462005 7:30618121-30618143 CTACTTTTTTTAAAACAAAAAGG + Intronic
1022590721 7:31659606-31659628 CTACATTTATTCAGATTAAATGG - Intergenic
1022965783 7:35469988-35470010 ATGCTTTTTTTCAGAAAAAAGGG - Intergenic
1023065375 7:36372520-36372542 CTATTTTCATTGAGGTAAAAAGG - Intronic
1023217901 7:37885161-37885183 CTTGTTTTATTGAGAGACAATGG + Exonic
1023896490 7:44437896-44437918 CTACTTTAACTTAGTAAAAATGG + Intronic
1025015565 7:55436327-55436349 CTGATTTTATAGAGAAGAAATGG - Intronic
1026173926 7:67978939-67978961 CCAGATTTATTGAGATAAAATGG + Intergenic
1027676430 7:81163893-81163915 CTTCGTTTATTTAGAATAAAAGG - Intergenic
1027736763 7:81942222-81942244 CTGGTTATATTGAAAAAAAAAGG - Intergenic
1028010042 7:85630513-85630535 CTATTTTTATTCAGCCAAAATGG - Intergenic
1028546919 7:92012251-92012273 CTACTTTCCTTGAAAAAGAAAGG + Intronic
1028619976 7:92814662-92814684 TTTCTTTTACTGAGAAAGAATGG - Intronic
1028944821 7:96565674-96565696 CTAATTTTACTGATGAAAAAAGG + Intronic
1030741535 7:113115466-113115488 CTACTTTTAAGGGGAAAATAGGG + Intergenic
1030861755 7:114640305-114640327 CTTTTTTTATGGAAAAAAAATGG + Intronic
1030918571 7:115349669-115349691 CTACTTTAATTGGGAAGGAAAGG + Intergenic
1031733549 7:125328403-125328425 CTCCTTTTAATGAGCCAAAATGG - Intergenic
1031873339 7:127110842-127110864 CTACGTTTATTGGGCAAAAGGGG + Intronic
1032378165 7:131445381-131445403 CTTCTTTTTTTGAAAAACAAAGG - Intronic
1032990804 7:137393223-137393245 CTGCTTTTTTTAAAAAAAAATGG - Intronic
1033896569 7:146078454-146078476 TCACTTTTATTTAGATAAAATGG - Intergenic
1034096916 7:148417811-148417833 CTACTCATTTTGGGAAAAAAGGG - Exonic
1034291665 7:149937392-149937414 CTGCTTTTATTCAGATCAAATGG - Intergenic
1034814424 7:154159506-154159528 CTGCTTTTATTCAGATCAAATGG + Intronic
1035440051 7:158889618-158889640 GTATTTTTATTGAAAAAAATAGG + Intronic
1037463575 8:19137404-19137426 TTACTTTTACTTAGAAACAATGG + Intergenic
1037512234 8:19595203-19595225 TAAATTTTATTAAGAAAAAAAGG + Intronic
1037921043 8:22805784-22805806 CTATTTTTTTTTAAAAAAAAGGG + Intronic
1038747406 8:30266563-30266585 CTATTTTTCTTGATAAAAACTGG - Intergenic
1039935096 8:42036155-42036177 CTACTGAAAATGAGAAAAAAAGG + Intronic
1040409897 8:47143560-47143582 CTACTTTTATTGTGATCAAGGGG - Intergenic
1040634767 8:49259998-49260020 TTTCTTTTATTGAAAATAAATGG + Intergenic
1040689832 8:49922916-49922938 GTACATTTATGGAGAAAAACAGG - Intronic
1042116079 8:65432929-65432951 AAACTTTTTTTAAGAAAAAAAGG + Intergenic
1042413763 8:68495359-68495381 CTATGTTTATTAAGATAAAATGG - Intronic
1042418361 8:68554240-68554262 CTACCTTTATTGACAATATAAGG + Intronic
1042647175 8:70999932-70999954 CTATTTTTAATAAGAGAAAAGGG - Intergenic
1042854666 8:73254460-73254482 CCACTTTTATTCTGTAAAAAAGG + Intronic
1043172449 8:76982280-76982302 ATAGTTTTATTGAAACAAAAGGG - Exonic
1043620448 8:82185120-82185142 TTACTTTTATTGATATATAATGG + Intergenic
1043688951 8:83126206-83126228 AGATTTTTATAGAGAAAAAAAGG + Intergenic
1043943055 8:86218099-86218121 CTAGTTTTATAGAAAATAAATGG - Intronic
1044071344 8:87763932-87763954 CTAGTTTTATACAGAAAAAAAGG - Intergenic
1044319090 8:90782134-90782156 ATACTTTCATCCAGAAAAAATGG + Intronic
1045666108 8:104486728-104486750 CTACCTTTATCAAGAAAATAAGG + Intergenic
1046329666 8:112698553-112698575 CTACTTTTATTGGCACAACAAGG - Intronic
1046388145 8:113530763-113530785 CTACTTTTTTTAAAAAAAATAGG + Intergenic
1046767782 8:118089090-118089112 TTATTTTTATACAGAAAAAAAGG + Intronic
1047463994 8:125094858-125094880 CTCTTTTTTTTGAGAAAAGAGGG + Intronic
1047589270 8:126309867-126309889 TTCCTTTTCTTGAGAAGAAAAGG - Intergenic
1048287213 8:133151279-133151301 TTTCTTTTAATGAGAATAAATGG + Intergenic
1048400980 8:134070379-134070401 CTAATTTGTTTCAGAAAAAATGG - Intergenic
1049367460 8:142247424-142247446 CTACTTTGAATGAGAGAAACAGG - Intronic
1049751830 8:144288589-144288611 CTACTCTTATTGAGAACAACAGG - Intronic
1050571701 9:6947261-6947283 CTAATTTTATTGGTAAAGAATGG + Intronic
1051601795 9:18882334-18882356 CTACTTTGAAGGAAAAAAAAAGG - Intronic
1052435340 9:28420655-28420677 TTACTTTTATAGAGAACAAATGG - Intronic
1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG + Intergenic
1054913460 9:70475026-70475048 GTACTTTTGTTGAGAAGAACAGG - Intergenic
1055636869 9:78287588-78287610 CTGCTTTTCATGAGAAAACAAGG + Intergenic
1056680346 9:88712114-88712136 TAACTATTTTTGAGAAAAAAAGG + Intergenic
1058113747 9:101060897-101060919 CCACTTTTTTTGTTAAAAAAAGG - Intronic
1058186260 9:101859293-101859315 CCATTATTATTCAGAAAAAAAGG + Intergenic
1058509373 9:105700305-105700327 CTACTATTATTGTGTAGAAAAGG - Intronic
1059704451 9:116807670-116807692 ATCCATTTATTGAGAAAATATGG + Intronic
1059731133 9:117058350-117058372 TTATTTTTATTGTGAAACAAGGG - Intronic
1060717690 9:125949212-125949234 CTCATTTTATAGATAAAAAATGG - Intronic
1061771689 9:132928988-132929010 CTTTTTTTATGGAGAAAAATGGG - Intronic
1062352711 9:136147139-136147161 CTGCTTTTTTTAAGAAAAGAGGG - Intergenic
1185723026 X:2397005-2397027 CCATTTTTATTTAGAGAAAAGGG + Intronic
1186755519 X:12667067-12667089 GTATTTTTATTTAGAAAGAAAGG - Intronic
1186884168 X:13896166-13896188 TTATTTTTAAGGAGAAAAAAAGG - Intronic
1187161008 X:16765297-16765319 CTTTATTTATTCAGAAAAAAAGG - Exonic
1188356701 X:29200579-29200601 ATTATTTTATTGGGAAAAAATGG - Intronic
1189633313 X:42977544-42977566 CCACTCTTAATGAGAAACAAGGG + Intergenic
1189960298 X:46318130-46318152 CTACTTTTATGCAGACAAAAGGG - Intergenic
1190406330 X:50091402-50091424 CTATTTTTATTGGAAAAGAAAGG + Intronic
1190439600 X:50463811-50463833 TTGCTTGTTTTGAGAAAAAAAGG + Intronic
1191235714 X:58132160-58132182 GTACTTTCATTGTGAAAAACAGG + Intergenic
1192617640 X:72644574-72644596 TTTCTTTTAAAGAGAAAAAAAGG + Intronic
1193085780 X:77447167-77447189 CCTCTTTTATTATGAAAAAATGG - Intergenic
1193571193 X:83146572-83146594 CTGGTTTTATTTAGAAAAGATGG - Intergenic
1193859474 X:86646435-86646457 ATACTTTTATTTAAAAAAAATGG + Intronic
1194270906 X:91813810-91813832 CTATTTTTATTCAGAAGAAAAGG - Intronic
1194478155 X:94386335-94386357 CTACTTTTATTAAGACAATGTGG + Intergenic
1195775802 X:108404855-108404877 CTACTTTTGGTGAAAAGAAAGGG - Intronic
1195895136 X:109738585-109738607 TTACTTCTATTGAGCAAAACAGG + Intergenic
1196200421 X:112880405-112880427 CTACTTGTATTCACATAAAAAGG + Intergenic
1196568256 X:117233841-117233863 CTTCTTCTATTTAGAAAAAAAGG - Intergenic
1196700308 X:118660786-118660808 CTACTTTATTTGAACAAAAATGG + Intronic
1197311204 X:124907902-124907924 AAACTTTTATTTAGAAAGAAAGG + Intronic
1197414100 X:126153162-126153184 CTTCTTTTAGAGAAAAAAAATGG - Intergenic
1197914359 X:131519220-131519242 CTTCTTTTATTTAGAATAAGTGG + Intergenic
1198010380 X:132546637-132546659 CTGCTATTATTGAGAATTAAAGG + Intergenic
1198440428 X:136658001-136658023 ACCATTTTATTGAGAAAAAAAGG - Intronic
1199001628 X:142645222-142645244 TTAAATTTATTCAGAAAAAAAGG - Intergenic
1199055561 X:143289770-143289792 TTGCTTTTATGAAGAAAAAAAGG + Intergenic
1199275294 X:145934347-145934369 TTAATTATATTGAGAAAAACTGG - Intergenic
1199365699 X:146979682-146979704 CTACGTTTATTGAGATAATCAGG + Intergenic
1199478363 X:148271145-148271167 CTACTTGTATTTAGAGAAATGGG - Intergenic
1200588147 Y:5035246-5035268 CTATTTTTATTCAGAAGAAAAGG - Intronic
1201574960 Y:15453442-15453464 ATACATTTTGTGAGAAAAAATGG + Intergenic
1202337210 Y:23824965-23824987 CAACTTTTATAGACAAACAAGGG - Intergenic
1202533555 Y:25845106-25845128 CAACTTTTATAGACAAACAAGGG + Intergenic