ID: 983241677

View in Genome Browser
Species Human (GRCh38)
Location 4:165240465-165240487
Sequence GTAAGGCATTTGAAAAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983241672_983241677 21 Left 983241672 4:165240421-165240443 CCAGATGGCCTCATTAGCTTTTG 0: 2
1: 0
2: 2
3: 13
4: 132
Right 983241677 4:165240465-165240487 GTAAGGCATTTGAAAAACCTTGG No data
983241673_983241677 13 Left 983241673 4:165240429-165240451 CCTCATTAGCTTTTGCTTAGAAG 0: 2
1: 0
2: 1
3: 17
4: 184
Right 983241677 4:165240465-165240487 GTAAGGCATTTGAAAAACCTTGG No data
983241671_983241677 22 Left 983241671 4:165240420-165240442 CCCAGATGGCCTCATTAGCTTTT 0: 2
1: 0
2: 2
3: 17
4: 175
Right 983241677 4:165240465-165240487 GTAAGGCATTTGAAAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983241677 Original CRISPR GTAAGGCATTTGAAAAACCT TGG Intronic
No off target data available for this crispr