ID: 983242413

View in Genome Browser
Species Human (GRCh38)
Location 4:165248495-165248517
Sequence AGACACGTGCTTCCAAGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983242411_983242413 -5 Left 983242411 4:165248477-165248499 CCAATGAGGAAGGTGAGCAGACA 0: 2
1: 0
2: 1
3: 22
4: 237
Right 983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG 0: 1
1: 0
2: 2
3: 13
4: 97
983242410_983242413 -4 Left 983242410 4:165248476-165248498 CCCAATGAGGAAGGTGAGCAGAC 0: 2
1: 0
2: 1
3: 12
4: 151
Right 983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG 0: 1
1: 0
2: 2
3: 13
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983242413 Original CRISPR AGACACGTGCTTCCAAGGAG CGG Intronic
900038283 1:434277-434299 AAACACGTGCGTACATGGAGGGG + Intergenic
900768613 1:4522257-4522279 AAACACATGGTTCCAAGGATTGG + Intergenic
904415342 1:30358033-30358055 AGACACCTGCCTCCCAGGAGGGG + Intergenic
906147485 1:43568658-43568680 GGACTTGTGCTTCCAAGGGGTGG + Intronic
907386351 1:54128043-54128065 AGATGTGTGCTTCCACGGAGGGG - Intergenic
920356351 1:205376076-205376098 AGAGACAGGCTTCTAAGGAGGGG - Intergenic
920882160 1:209890053-209890075 AGGCACGAGCCTCCAAGGTGAGG - Intergenic
1064984392 10:21195537-21195559 AGACAGGTGCTTTCAATGACTGG + Intergenic
1070959356 10:80488018-80488040 AGAAACCAGCTTCCACGGAGTGG - Intronic
1072940754 10:99761439-99761461 AGACAACTGGTACCAAGGAGAGG - Intergenic
1074370700 10:112898771-112898793 GGAAAGGTGCTTCCAGGGAGAGG + Intergenic
1076749640 10:132536354-132536376 AGACACCTGCTGCCAGGGCGGGG - Intergenic
1080819431 11:35791127-35791149 GGACACTTGCTCCCAAGCAGAGG - Intronic
1088995600 11:114993610-114993632 AAACATGTGCTTCAGAGGAGCGG - Intergenic
1091015908 11:132050585-132050607 AGATCTGTACTTCCAAGGAGAGG + Intronic
1092087190 12:5772882-5772904 AAACACGTGCTGTCAAGAAGGGG + Intronic
1104797814 12:131531840-131531862 AGACAGGTGTTTCCAAGGAAAGG - Intergenic
1105321141 13:19323577-19323599 AGGCACGTGGTTGCAAGGTGCGG + Intergenic
1105617428 13:22031568-22031590 AGACACATGGTTCCAATGAGAGG - Intergenic
1105934285 13:25084963-25084985 AGACAACTGCTACCAAGGAAGGG - Intergenic
1106437212 13:29733578-29733600 AGAAAAGTGTTTCCAAGCAGGGG - Intergenic
1107047234 13:36006574-36006596 AGGCCAGTGCTTCCCAGGAGAGG + Intronic
1108481573 13:50877772-50877794 AGCCTCGTGCTTTCTAGGAGGGG + Intergenic
1117967944 14:61224798-61224820 AGAAACTTGCTTCCAAAGAGTGG - Intronic
1119104027 14:71907227-71907249 AGATAAGTGCTGCAAAGGAGAGG + Intergenic
1119553336 14:75533641-75533663 AGTCCCCTGCTTCCTAGGAGGGG + Intronic
1121219709 14:92276439-92276461 AGACAAGTGCTTTCAAGGCGAGG - Intergenic
1121814729 14:96920502-96920524 AGACAAGAGCAGCCAAGGAGAGG - Intronic
1122286410 14:100655153-100655175 GCACACGTGGTTCCACGGAGGGG + Intergenic
1132283498 15:100641718-100641740 AGACTCCAGCTTCCAAAGAGGGG + Intronic
1134674858 16:16083038-16083060 AAACCCCTGCTTCCAAAGAGTGG - Intronic
1135932952 16:26754797-26754819 AAACGCGTGCTCCCAATGAGTGG - Intergenic
1137760992 16:50940223-50940245 AGACATTTCCTCCCAAGGAGAGG - Intergenic
1139673616 16:68508564-68508586 AGATGGGTTCTTCCAAGGAGAGG + Intergenic
1141646322 16:85369958-85369980 AGCCCCGTGTTCCCAAGGAGGGG - Intergenic
1143668774 17:8382029-8382051 AGACTCTTGCTCCCAAAGAGTGG - Intronic
1145758667 17:27411752-27411774 AAGCAAGTGGTTCCAAGGAGTGG + Intergenic
1151516964 17:74602802-74602824 AGAGAGGTGGCTCCAAGGAGAGG - Intergenic
1153917972 18:9762517-9762539 AGACAGGTGCTTCCTTGGATAGG + Intronic
1155518825 18:26649161-26649183 AGTCACGTGCTGCCAGGGAATGG - Intronic
1155866511 18:30972659-30972681 AGAAACGTGGATCCAAGGACAGG - Intergenic
1158223017 18:55169428-55169450 AAACACCTGTTTCCAAGTAGAGG + Intergenic
1160442527 18:78903272-78903294 GGGCACTTGCTTCCAGGGAGTGG + Intergenic
1160451782 18:78971419-78971441 AGACACGTCCTTCCCAGGCCTGG - Intergenic
1161052552 19:2172150-2172172 AGAAAAGTGCGTCCGAGGAGTGG - Intronic
1161160011 19:2756695-2756717 AGACACCGGCTTCCCAGGGGTGG - Intronic
1163174148 19:15552470-15552492 GGACAGGTGCTCCAAAGGAGAGG + Intergenic
1167254147 19:48417264-48417286 AGCCACTTGCTTCCACAGAGTGG - Intronic
927326377 2:21810369-21810391 ATAAACATTCTTCCAAGGAGAGG + Intergenic
932041015 2:68299737-68299759 ACACATCTGATTCCAAGGAGAGG + Intronic
934153509 2:89172890-89172912 AGACACGTGCATCCAACACGTGG + Intergenic
942833088 2:180260199-180260221 ACACACGTGATTCATAGGAGAGG - Intergenic
944444101 2:199772583-199772605 AGACACGTGCTTCAGAGGGTGGG - Intronic
1170960286 20:21019802-21019824 AAACACCTGCTTCCAAACAGTGG + Intergenic
1172582638 20:36060448-36060470 AGTAACTTGCTTCCAAAGAGTGG + Intergenic
1175854156 20:62111075-62111097 AGACAATTGTTACCAAGGAGTGG + Intergenic
1176085913 20:63295376-63295398 AGAGATGTGCTCCCAAGGCGAGG - Intronic
1178876268 21:36416442-36416464 AGACCAGGGCTTCCATGGAGCGG + Exonic
1179101828 21:38361068-38361090 AGAGAGGTGCTGCCAAGCAGAGG - Intergenic
950714295 3:14836829-14836851 AGCCACGTGCTTTGAAGAAGAGG + Intronic
953353020 3:42230252-42230274 AGACTCCTGGTCCCAAGGAGGGG - Intergenic
953699580 3:45185420-45185442 AGAGAGGTGCTGCCAAGGAAGGG + Intergenic
954432714 3:50479770-50479792 AGGCACTTGATTCCAAGCAGAGG - Intronic
960789473 3:121412324-121412346 CTACATGTGCTTCCCAGGAGGGG - Intronic
964504547 3:157384532-157384554 AGACACATGCTTTAAAGAAGGGG - Intronic
964721082 3:159767677-159767699 AGACACTTGCTTCCAAGCAGAGG - Intronic
965150105 3:164962353-164962375 AGACATGTGCTTGCATGGATTGG - Intergenic
967215681 3:187208129-187208151 AGAAAATTGCTACCAAGGAGTGG - Intergenic
970254009 4:14147974-14147996 AGACACATGCTTACAGGAAGGGG + Intergenic
972901354 4:43687960-43687982 AGACAGGTGGTTCAAAGAAGGGG + Intergenic
983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG + Intronic
984548279 4:181132255-181132277 ATACACCCGTTTCCAAGGAGGGG + Intergenic
985081677 4:186271631-186271653 GGACACCTGCTTTGAAGGAGGGG + Exonic
985587102 5:746139-746161 AGCCACGAGCTTCCATGGAGGGG + Intronic
985601673 5:838322-838344 AGCCACGAGCTTCCATGGAGGGG + Intronic
991145298 5:63295876-63295898 AGACAAGTGAATCCAAGGACTGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997308995 5:132864231-132864253 AGACATATGCTACCAAGGAAGGG - Exonic
1002735724 5:181385282-181385304 AAACACGTGCGTACATGGAGGGG - Intergenic
1002735743 5:181385359-181385381 AGACACGTGGATACATGGAGGGG - Intergenic
1002735784 5:181385513-181385535 AGACACGTGGATACATGGAGGGG - Intergenic
1004658440 6:17687807-17687829 AAACACGTGCTTTAAAGGATAGG + Intronic
1006847715 6:37074341-37074363 ACACACCTGCCTCCAAGAAGAGG - Intergenic
1011166054 6:84447735-84447757 ACACAGTTGCTTCCAAGAAGGGG + Intergenic
1011752926 6:90471613-90471635 AGTCACGTGCTTCCAAGCCAAGG - Intergenic
1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG + Intronic
1016163283 6:140908025-140908047 AGGCAGGTCATTCCAAGGAGTGG + Intergenic
1017312871 6:152994476-152994498 AGGCCCGGGATTCCAAGGAGAGG + Intronic
1019841659 7:3452328-3452350 AATCACCTGCTTCCAAAGAGTGG - Intronic
1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG + Intronic
1024129156 7:46332769-46332791 AGACAGGTGCCTGCAGGGAGAGG + Intergenic
1031625759 7:123991271-123991293 TGACAAGTGCTTCCAAGGACTGG + Intergenic
1036576128 8:10029307-10029329 AGACACCTGCTGTCAGGGAGAGG + Intergenic
1037701709 8:21281292-21281314 AGACATGTGATTCCCAGGAATGG - Intergenic
1037732687 8:21541516-21541538 AGAAAATTGCTGCCAAGGAGTGG - Intergenic
1038711725 8:29953176-29953198 AGATACATGATTCCAAGGAGAGG + Intergenic
1038857497 8:31349516-31349538 ACACATGTGCTTCCAAGGATGGG + Intergenic
1039124484 8:34185839-34185861 AGACATCTGGTTCCAAGGAAAGG + Intergenic
1041123855 8:54614564-54614586 AGACAAGTGATACCAGGGAGAGG + Intergenic
1045219588 8:100185435-100185457 TGACAAGTGCTACAAAGGAGAGG - Intronic
1045506096 8:102779794-102779816 ACACACCTGCTTTCAAGCAGTGG + Intergenic
1045747404 8:105439743-105439765 AGAAAAGTGCTTGGAAGGAGTGG + Intronic
1048512942 8:135078845-135078867 AGACAAGGGATTCCAAGGTGAGG - Intergenic
1048996437 8:139796436-139796458 AGACACATGCATTCAAGGAGTGG - Intronic
1055495054 9:76845894-76845916 AGCCACCTGCTTCCAAAGAGTGG - Intronic
1057877582 9:98769638-98769660 AGGCACGTGGTTCCAAGAACAGG + Intronic
1061226375 9:129283286-129283308 AGACCCCTGCTGCCAAGGGGCGG + Intergenic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1061946472 9:133911086-133911108 AGACCTGTGCTCCCAAGAAGGGG - Intronic
1186515991 X:10166486-10166508 AGCCATGTGCCTCCATGGAGAGG - Intronic
1187665630 X:21606206-21606228 TGCCATGTGTTTCCAAGGAGAGG + Intronic
1195649869 X:107273223-107273245 AGAAAGCTGCTTCCAAGAAGGGG + Intergenic
1197959242 X:131985964-131985986 AGACACGTGGTACCAACTAGAGG + Intergenic