ID: 983243786

View in Genome Browser
Species Human (GRCh38)
Location 4:165264016-165264038
Sequence CCTGAAGAGCAGCTAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 2, 2: 3, 3: 16, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983243786_983243790 6 Left 983243786 4:165264016-165264038 CCTTGCTTTAGCTGCTCTTCAGG 0: 1
1: 2
2: 3
3: 16
4: 186
Right 983243790 4:165264045-165264067 AGACCCCTCATCTCTGCAGTTGG 0: 1
1: 1
2: 1
3: 16
4: 211
983243786_983243792 8 Left 983243786 4:165264016-165264038 CCTTGCTTTAGCTGCTCTTCAGG 0: 1
1: 2
2: 3
3: 16
4: 186
Right 983243792 4:165264047-165264069 ACCCCTCATCTCTGCAGTTGGGG 0: 1
1: 1
2: 0
3: 40
4: 232
983243786_983243796 11 Left 983243786 4:165264016-165264038 CCTTGCTTTAGCTGCTCTTCAGG 0: 1
1: 2
2: 3
3: 16
4: 186
Right 983243796 4:165264050-165264072 CCTCATCTCTGCAGTTGGGGAGG 0: 2
1: 0
2: 3
3: 36
4: 334
983243786_983243791 7 Left 983243786 4:165264016-165264038 CCTTGCTTTAGCTGCTCTTCAGG 0: 1
1: 2
2: 3
3: 16
4: 186
Right 983243791 4:165264046-165264068 GACCCCTCATCTCTGCAGTTGGG 0: 1
1: 1
2: 0
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983243786 Original CRISPR CCTGAAGAGCAGCTAAAGCA AGG (reversed) Intronic
901349730 1:8583473-8583495 TGTGAAGAGCAGCTGAAGCCTGG + Intronic
904876354 1:33657514-33657536 CCTTGAGAACAGCAAAAGCAAGG + Intronic
906056044 1:42917451-42917473 GCTGAAGAGCTCCTCAAGCATGG + Intergenic
906618734 1:47255892-47255914 CCAGAAGAGTGGCTAAGGCAGGG - Intronic
906670936 1:47654223-47654245 CCTGAGGACCAGCTGAAGCTTGG + Intergenic
910889439 1:92001740-92001762 ACTGGAGAGCTGCTATAGCATGG + Intronic
911180040 1:94852388-94852410 CCATAAGACCATCTAAAGCAAGG + Intronic
913497635 1:119443052-119443074 CCTGGGGAGGAGATAAAGCAAGG + Intergenic
913532560 1:119743121-119743143 CATGAAGAGGGGCTAAAGGAAGG - Intronic
914196111 1:145448868-145448890 CCTGGGGAGCAGCTCCAGCAGGG - Intergenic
914413848 1:147459229-147459251 TCTGAAATACAGCTAAAGCAGGG + Intergenic
914456777 1:147843830-147843852 CCTGAAGAGAAGCCTAAGAAAGG + Intergenic
917034372 1:170730751-170730773 CCTGAGGAGCAGCAGAAGCCAGG - Intronic
918141559 1:181724335-181724357 CCTGAAGAGTCACTTAAGCAGGG - Intronic
918186247 1:182130071-182130093 CTTGGGGAGCAGGTAAAGCATGG - Intergenic
919370927 1:196724596-196724618 CATGGAGAGAAGCCAAAGCATGG - Intronic
920207631 1:204304240-204304262 CCTGAATAGCAGGGATAGCAGGG - Intronic
922050623 1:221987094-221987116 CCTCAAGTGCAGCTACAGCCTGG - Intergenic
923018184 1:230142962-230142984 TCTGAAGAGCAGCCACAGGAAGG - Intronic
1068949353 10:62761778-62761800 CCTGAAGGGCAGCTCACCCAAGG - Intergenic
1069896850 10:71685364-71685386 CCTGTAGCTCAGCTAAGGCAGGG + Intronic
1072322895 10:94268342-94268364 CCAGAATAGCAACTAGAGCAGGG - Intronic
1072422834 10:95303896-95303918 CCTGAACAGCAGCTACAGGATGG + Intergenic
1072965465 10:99968723-99968745 CCTGAAGTGTGGCTATAGCATGG + Intronic
1073272566 10:102277915-102277937 CATAAAGAGAAGCTAAAGAACGG - Intronic
1075300413 10:121317513-121317535 CCTGGAGAGCAACTGAGGCAGGG - Intergenic
1076583684 10:131531649-131531671 CCTGAACAGCAGCTATGGAAAGG - Intergenic
1083908197 11:65687975-65687997 GCTGAAGACCAGCTGAAACAGGG + Intergenic
1084503331 11:69548702-69548724 TATGAAAAGCAGCTACAGCAGGG + Intergenic
1085255053 11:75167816-75167838 TCAGAACAGCAGCTAAGGCAGGG - Intronic
1087898206 11:103611141-103611163 CCTGCAATGCAGGTAAAGCAAGG - Intergenic
1096220850 12:49827680-49827702 GCTGAAGAGAAGCTAAGGGAGGG - Intronic
1098840533 12:75472446-75472468 CCTCAAGGGCAGCTAAAGTAAGG + Intergenic
1100206948 12:92360523-92360545 CCTGCAGAGCAGCTAGAGAAAGG + Intergenic
1102944928 12:116978213-116978235 CATAAAGAACAGCTAAACCACGG - Intronic
1104303100 12:127583833-127583855 TATGAGAAGCAGCTAAAGCAGGG - Intergenic
1105479173 13:20757535-20757557 CCTGGAGAGCTGCTAAGGCATGG + Exonic
1107611153 13:42114317-42114339 CCTGAAGAGCTCCTAAAGATAGG + Intronic
1109287582 13:60428458-60428480 GCTGAAGATCAGCTGAAGAAAGG + Intronic
1111861348 13:93711064-93711086 AATGAAGTGCAGCTAAAACAAGG + Intronic
1113682361 13:112253360-112253382 CCTGAGGCGCAGCTACAACATGG - Intergenic
1114706253 14:24729482-24729504 CCTGAGACACAGCTAAAGCAGGG + Intergenic
1118242527 14:64073855-64073877 CCTGAATAGCTACTAAAGGATGG - Intronic
1118243933 14:64089670-64089692 CCTGAAGAACATCTCAAACATGG + Exonic
1118320563 14:64749870-64749892 CCTGAGGAGCAGCTCAGGCCTGG + Exonic
1118345839 14:64940125-64940147 CTTGAAGAGCAGCCAAAGCATGG - Intronic
1118485424 14:66210207-66210229 CCTGGGGAGCAGCAAATGCAGGG + Intergenic
1118786094 14:69046334-69046356 CCAGAAGAGAAGCCAGAGCAAGG - Intergenic
1120101061 14:80446091-80446113 GCTGAAGAGCAGCTCTAACAAGG + Intergenic
1120144854 14:80968498-80968520 CCTTAAGATCAGCTGCAGCAGGG - Intronic
1120400472 14:84024346-84024368 CCAGAAGAACAGCAAAATCAGGG + Intergenic
1122758103 14:103998285-103998307 ACAGAAGAGCAGCTGATGCAAGG - Intronic
1127359063 15:58229138-58229160 CCTGAAGAAAAGCTAAATTATGG - Intronic
1127729474 15:61785717-61785739 CCATATCAGCAGCTAAAGCAAGG + Intergenic
1130230594 15:82093748-82093770 AATGAGGAGCAGCTTAAGCAAGG + Intergenic
1131558232 15:93417749-93417771 TCTGCAGAGAAGCTAAAGGAAGG - Intergenic
1133399696 16:5476201-5476223 ACTGCAGAACAGCTAAATCAAGG - Intergenic
1135435732 16:22425574-22425596 CCAGATGAGCAGCCAAAGCCGGG + Intronic
1137677245 16:50309779-50309801 CCTGCAGAGCTGGGAAAGCAGGG + Intronic
1141538698 16:84700785-84700807 CCTGAACAGTAGCTAAAGCTTGG + Intronic
1142044939 16:87919378-87919400 CCAGACGAGCAGCCAAAGCCGGG + Intronic
1142315209 16:89339797-89339819 GCTGAGGAGCAGCCACAGCAGGG - Intronic
1143368573 17:6424196-6424218 CTTGAAGATGAGCTAAAACAGGG + Exonic
1144004563 17:11088556-11088578 CCTGCAGAGCAGGTAATGGATGG + Intergenic
1144221108 17:13100631-13100653 ACTGAAGACTAGCTAAAACAGGG - Intergenic
1152792831 17:82291415-82291437 ACAGAAGAGCAGCTGACGCAGGG - Intergenic
1152808131 17:82367795-82367817 CCTGGAGAACAGCGAAAGCGAGG + Intergenic
1153664989 18:7360568-7360590 CCTGAAGGGCTCCTCAAGCATGG - Intergenic
1154013231 18:10593386-10593408 CCTGAAAAGTAACTAAATCAAGG - Intergenic
1154152398 18:11916649-11916671 CCTGAAAAGTAACTAAATCAAGG - Intergenic
1155551192 18:26967368-26967390 GCTGAAGAGCATCTACACCATGG - Intronic
1155751793 18:29433275-29433297 CCTGGGGAGCAGCAAAACCAAGG + Intergenic
1158882776 18:61796912-61796934 CCTGATGAACATCTAAATCAGGG + Intergenic
1158942400 18:62417473-62417495 CATTCAGAGCAGCTCAAGCATGG + Intergenic
1159020563 18:63139643-63139665 CCTGAAGAGGCCCTAAAGAAAGG + Intronic
1159609433 18:70509698-70509720 TCTCAAGAGCAGCTAAAGCAGGG - Intergenic
1161248143 19:3266294-3266316 ACTGAAGACTAGCTAAAACAGGG - Intronic
1165429150 19:35762323-35762345 CCTGAAGGGGAGCCACAGCATGG - Exonic
1165593793 19:36994075-36994097 TATGAAATGCAGCTAAAGCAGGG - Intronic
1166041113 19:40203622-40203644 CCTGCTCATCAGCTAAAGCAGGG + Intronic
1166339985 19:42131723-42131745 CGTGAAGAAAAGATAAAGCAGGG + Intronic
1167493036 19:49802694-49802716 CCTGATGAGCAGCAGAGGCAGGG + Intronic
926381626 2:12296321-12296343 CCTGCAGGGCAGCTGAAGCTAGG - Intergenic
927557519 2:24046320-24046342 CCTGAAGAGCATTTAAACCTTGG - Intronic
929636052 2:43521645-43521667 CCTGAATAGCAGCTATAGCCTGG - Intronic
929658399 2:43757248-43757270 TCTGAAGAGCAGTTAAGGTAAGG + Exonic
929783185 2:44971035-44971057 ACTGAGGAGCGGCTGAAGCAAGG + Intergenic
932417604 2:71583321-71583343 CCTGAAGAGCACCTGTGGCAGGG - Intronic
933139737 2:78778889-78778911 CCTGAAGGGCTCCTCAAGCACGG - Intergenic
934096826 2:88614526-88614548 CCACAGGAGCAGCTGAAGCAAGG - Intronic
937751492 2:125479620-125479642 CCTGAAGGGCTCCTCAAGCATGG + Intergenic
939362402 2:141189862-141189884 CCTGGGGAGCAGCCAATGCAGGG + Intronic
942120245 2:172769586-172769608 CCTGGGGAGCAGCAAATGCAGGG - Intronic
943360307 2:186911418-186911440 CCAGAAGAGCAGCGGAGGCAAGG + Intergenic
944213298 2:197228738-197228760 TCTGAAGAGCAGTTACAGCCTGG + Intronic
945207204 2:207344620-207344642 CCTGTAGAGGGGCTAAAGCCAGG + Intergenic
945750803 2:213780131-213780153 GCTGAAGAGCAGCCAAAGCAAGG - Intronic
948675907 2:239596571-239596593 ACTGAAGACTAGCTAAAACAGGG - Intergenic
1170972249 20:21126426-21126448 CGTCAATAGCAGCTAAAGCCTGG + Intronic
1172567930 20:35945582-35945604 CCTGGAGTGCAGCAAAAGAAAGG - Intronic
1173559045 20:43989306-43989328 CCTGAGGAGCAGTTAGAGAATGG + Intronic
1173978830 20:47207502-47207524 CCTGAAGACCAGAGAAAGGAGGG - Intergenic
1174978593 20:55363945-55363967 CCTGAAGAGAAGGAAAAACATGG + Intergenic
1175255445 20:57643524-57643546 CCTGAGGACTAGCTAAAACAGGG + Intergenic
1177448735 21:21237051-21237073 TCTGAAAAGCAGAGAAAGCAGGG - Intronic
1178898001 21:36576582-36576604 CCTGAGGCCCAGCTAAAGCAGGG - Intergenic
1179423467 21:41254293-41254315 ACTGAAGAGCAGGTCAAGTAGGG - Intronic
1180127317 21:45801261-45801283 ACAGAGGAGCAGCTAAGGCAAGG - Intronic
1182615221 22:31583864-31583886 CCTGTGCAGCAGCTAAAGCAAGG - Exonic
1183589514 22:38771695-38771717 CCTGGAGAGCAGTCAAAGCAGGG + Intronic
1183998961 22:41658272-41658294 CCTGAAGTGCTGCTGCAGCACGG - Exonic
1184621390 22:45681365-45681387 CCTAAAGAGAAGATAAAACAGGG - Intronic
950315058 3:11994867-11994889 GCTGAAGAGCAGTTCAAGGAAGG + Intergenic
950620759 3:14203402-14203424 CCTGAATACCAGCTTGAGCAGGG - Intergenic
950700458 3:14742015-14742037 ACTGAGGATTAGCTAAAGCAGGG - Intronic
951044407 3:18022363-18022385 CCTGGTGAGAAGCTGAAGCAGGG + Intronic
952270903 3:31830409-31830431 CCAGAAGGGCAGCTAAGGAAGGG - Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
952960799 3:38588005-38588027 CCTGAGGAGCAGGAACAGCAAGG - Intronic
953271550 3:41450213-41450235 CCTGAAGGAAAGATAAAGCAAGG - Intronic
957308955 3:78494499-78494521 CTTGTCTAGCAGCTAAAGCATGG - Intergenic
957423076 3:79997676-79997698 ACTGAAAAGCAGAAAAAGCAAGG - Intergenic
957724278 3:84044663-84044685 CCTAAAGATCAGGTAAAGAAAGG + Intergenic
958665671 3:97135020-97135042 CCTGAAAAACAGCAAACGCAGGG - Intronic
958945414 3:100356275-100356297 CATGAAAAGCAGCAAAATCAGGG - Exonic
959158402 3:102694701-102694723 CCTGCAGAGAATCTAAAGAAAGG + Intergenic
960868645 3:122227639-122227661 CCTGAAGGGCTCCTCAAGCACGG + Intronic
963055385 3:141182252-141182274 CATGGAGGGCAGCTAATGCAGGG - Intergenic
963405579 3:144859421-144859443 CCTGAAGTGCAGGCACAGCATGG - Intergenic
964912185 3:161796872-161796894 GCAGAAAAGCAGCTGAAGCAAGG - Intergenic
966852309 3:184171641-184171663 CCTGAGGGGCTGCTGAAGCAGGG - Exonic
967921733 3:194619130-194619152 CCTGAGCAGCAGCAAGAGCAAGG - Intronic
967945847 3:194803539-194803561 CCTCAAGAGCAGCTAAATGTTGG + Intergenic
968562413 4:1291095-1291117 TATGAAGACCAGCTACAGCAGGG - Intronic
969176193 4:5400723-5400745 TCAGAAGAGCAGGTAAAGGAGGG - Intronic
969929812 4:10620048-10620070 CGTGAAGAGCAGAGAAAGGAAGG - Intronic
970189389 4:13497771-13497793 CATGAAGAGAAGCTCAAGCGTGG + Intergenic
970685038 4:18557647-18557669 TCAGAAGAGCACCTGAAGCATGG - Intergenic
971028952 4:22616300-22616322 GCTGAAGAGCATCTACAGCATGG - Intergenic
971607800 4:28680930-28680952 CCTGGGGAGCAGCAAATGCAGGG + Intergenic
976333996 4:83864567-83864589 CCTGAAGTCCAGCTAAAACTAGG - Intergenic
977521213 4:98086808-98086830 CCTGAGGAGCAGGGAAAGAATGG - Intronic
979325870 4:119378868-119378890 CCTGAACAGCAGCTAAAGCAAGG - Intergenic
981271204 4:142847993-142848015 CTTGAAGAGAAGCAAAAGGAAGG - Intergenic
981904031 4:149899521-149899543 TGTGAAATGCAGCTAAAGCAGGG - Intergenic
982848133 4:160276710-160276732 CCTGAAAAGGGGCTAAAGCCAGG + Intergenic
983046247 4:162989934-162989956 TTTGCAGAGCAGCTGAAGCATGG + Intergenic
983243786 4:165264016-165264038 CCTGAAGAGCAGCTAAAGCAAGG - Intronic
983702572 4:170615674-170615696 CATGAGGAGCAGGCAAAGCAGGG - Intergenic
987592009 5:19942081-19942103 CCTAAAGAGCAGATAAATAATGG + Intronic
988726352 5:33930223-33930245 ACTGAAGAGCATCTAGAGAAAGG + Intergenic
990494329 5:56332432-56332454 CCTGAAATGCAGGTGAAGCAGGG - Intergenic
994203662 5:97008160-97008182 CCTGAAGCACAGCTAAAACATGG + Intronic
998486665 5:142508877-142508899 CCTGAGCAGCAGCTAAAGGGAGG + Intergenic
1002212520 5:177607335-177607357 CCTGGAGAGCAGCAACAGCACGG + Exonic
1004311633 6:14551315-14551337 GCTGAAAAGCAGGTAAAGGAGGG - Intergenic
1004428107 6:15519811-15519833 CCTTATGAGCAGGCAAAGCATGG + Intronic
1006733810 6:36257174-36257196 CCTGGGGAGCAGCAAATGCAGGG - Intronic
1007192802 6:40034025-40034047 CCAGAAGAGTCGCAAAAGCAGGG + Intergenic
1010634195 6:78236665-78236687 CCTGAAGCAAAGCTATAGCAAGG + Intergenic
1012598799 6:101070161-101070183 GCTGAAGAGCTCCTCAAGCACGG - Intergenic
1013643048 6:112106967-112106989 CCTGATGATCTGCCAAAGCATGG - Intergenic
1014088437 6:117373748-117373770 CCTGAAGGGCTCCTCAAGCATGG + Intronic
1014678416 6:124397888-124397910 CCTGAAGTGGACCTAAAGCCAGG + Intronic
1016545190 6:145213942-145213964 ACTGAAGAGCATCTAAAGAATGG - Intergenic
1020716635 7:11681840-11681862 CCTGAAAGGCAGCTAGAGAAAGG + Intronic
1021224648 7:18013134-18013156 CATGGAGAGCTGCCAAAGCAGGG - Intergenic
1021920849 7:25483504-25483526 CCTGAAGCACAGCTCAAGCCAGG - Intergenic
1022621044 7:31984972-31984994 CCTTCAGAGTAGCTAAGGCATGG - Intronic
1022729227 7:33007094-33007116 CCTGAAGAGAAGCTAAGGAAAGG + Intergenic
1024624491 7:51193398-51193420 CCTGAAGAGAAGGTTAAGCCTGG - Exonic
1025044428 7:55680886-55680908 CCTGAAGAGCAGCTAAAGAAGGG - Intergenic
1025235931 7:57234861-57234883 CCTGAGGAAAAGATAAAGCATGG - Intergenic
1025875837 7:65478986-65479008 CCTGGTGAGCAGCTATGGCAGGG - Intergenic
1027487290 7:78778021-78778043 CATAAAGAGCAGCTCAAGAAAGG - Intronic
1029266978 7:99350057-99350079 CCAGAAAAGGAGCTCAAGCATGG + Intronic
1029366653 7:100120702-100120724 CCTGCAGAGGTGTTAAAGCAAGG - Intronic
1032686879 7:134243333-134243355 GCTGATGAGCAGCTTCAGCAAGG + Intronic
1033046095 7:137963233-137963255 CCTGAAGAGCAGGTAAATTCTGG - Intronic
1034168613 7:149045282-149045304 CCTGAAGAGCAGCAAGGCCACGG + Intergenic
1034549688 7:151812638-151812660 CCTGAAGAGAAGCCAGAGCTGGG + Intronic
1035186017 7:157126202-157126224 CCGGAAAAGCACCTGAAGCAAGG + Intergenic
1039306594 8:36269973-36269995 TGTGGAGAGCAGCTAAAGGAGGG + Intergenic
1042627184 8:70770888-70770910 CCTGAAAGGCAGCTAAGGCCAGG - Intronic
1045035952 8:98176612-98176634 CCTGCAGAGCAGCTGACCCAAGG - Intergenic
1045539736 8:103072058-103072080 GCTGAAGAGCAACTTCAGCAGGG - Exonic
1048487944 8:134866003-134866025 CTTGAAGAGCATCTAGAACAAGG - Intergenic
1051212894 9:14763863-14763885 CTTGTAGAGCATCTAAAACATGG + Intronic
1052202909 9:25804201-25804223 GCTGAAGAGCAGCAAAGGCAGGG + Intergenic
1057479476 9:95433512-95433534 GCTGATGAGCAGTTAAATCAGGG - Intergenic
1057699445 9:97352538-97352560 CCTGGGGAGCAGCAAATGCAGGG - Intronic
1058196989 9:101989333-101989355 TTTGAAGAGCAGCTCAAACAAGG + Intergenic
1059891511 9:118809678-118809700 GCTGAAGAGCTCCTCAAGCACGG + Intergenic
1060239880 9:121893929-121893951 TCTGAAGAGCAGCTGCAGGATGG + Intronic
1060484141 9:124036591-124036613 CCTGAAGACCACCTAATGCCAGG - Intergenic
1062378621 9:136276206-136276228 CCTGAAGAGCAGCCCATCCAGGG + Intergenic
1062698621 9:137887967-137887989 CCTGGGGAGCAGCTCCAGCAGGG + Intronic
1185500492 X:593419-593441 CCTGAAGAGCCACTAAAACTGGG - Intergenic
1187203992 X:17164633-17164655 TGTGAAATGCAGCTAAAGCAGGG + Intergenic
1189136857 X:38559515-38559537 CCTGAAGAGCTTCTAAAACGCGG + Intronic
1189528978 X:41858469-41858491 GCTGAAGAGCAGGAAATGCAGGG + Intronic
1190570528 X:51777187-51777209 CCTAAAGAGCTGGTAAAACAAGG + Intergenic
1194041729 X:88949588-88949610 CCTGAAGAGCAGTCAAAAGAAGG + Intergenic
1196079604 X:111617460-111617482 CCTGGAGATCAGGTAAAGAAGGG - Intergenic
1196756388 X:119160985-119161007 CCAGAAGAGCAGGAAAAGCCAGG - Intergenic
1197939833 X:131778026-131778048 CCTGAAGAGTATGTAATGCATGG + Intergenic
1199681985 X:150231437-150231459 CCTGAAGTGCTGCTGCAGCACGG + Intergenic
1201607229 Y:15800259-15800281 TCACAAGAGCAGCTAAAGCAAGG + Intergenic