ID: 983251851

View in Genome Browser
Species Human (GRCh38)
Location 4:165354485-165354507
Sequence CTGTGGACCAGTACCCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983251851_983251862 25 Left 983251851 4:165354485-165354507 CCATGATGGGTACTGGTCCACAG No data
Right 983251862 4:165354533-165354555 AATGAATGAATTAAAAAATATGG No data
983251851_983251856 -10 Left 983251851 4:165354485-165354507 CCATGATGGGTACTGGTCCACAG No data
Right 983251856 4:165354498-165354520 TGGTCCACAGCCCGGGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983251851 Original CRISPR CTGTGGACCAGTACCCATCA TGG (reversed) Intergenic
No off target data available for this crispr