ID: 983252952

View in Genome Browser
Species Human (GRCh38)
Location 4:165365456-165365478
Sequence CCCATTGGGTGCTCTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983252952 Original CRISPR CCCATTGGGTGCTCTGAAGC TGG Intronic
902669996 1:17966573-17966595 CCCATTGGTTGCTGTTGAGCTGG + Intergenic
902907846 1:19572176-19572198 AACATGGGGTGCTCTGGAGCTGG + Intergenic
904341221 1:29836189-29836211 CCCATTAGGTGCTCTGAGATTGG - Intergenic
906364188 1:45191534-45191556 CCTATGGGGAGCTCTGCAGCTGG - Intronic
908427078 1:64017705-64017727 CCCTGTGGGTGCTCTGCAGATGG + Intronic
910457415 1:87412373-87412395 CCCAAAGGGAGCTCTGGAGCTGG + Intergenic
910533928 1:88274685-88274707 CCTATTGAGTACTCAGAAGCAGG - Intergenic
913554797 1:119954623-119954645 GCCAGTGTGTGCTCTGAAGTAGG - Intronic
914714140 1:150240141-150240163 CCAACAGGGTGCTCTGGAGCTGG - Intergenic
914846577 1:151286939-151286961 ACCATTGGGGGCCTTGAAGCAGG + Exonic
915035701 1:152922232-152922254 CCCATTGGCTGAACTGAAACAGG - Intergenic
915633370 1:157169311-157169333 GCCATTGGCTGCTCTGTAGCAGG + Intergenic
916618184 1:166466969-166466991 ACCATTGGGTGGTTTCAAGCAGG + Intergenic
922393771 1:225175179-225175201 CCCAATGTGTTCTATGAAGCTGG - Intronic
922435175 1:225598083-225598105 CCAGCTGGGTGCTCTGAAGAAGG - Intronic
922448288 1:225716257-225716279 ACCATGGGAAGCTCTGAAGCTGG - Intergenic
923001698 1:230011564-230011586 CCTTTTGGGAGGTCTGAAGCAGG - Intergenic
924621872 1:245668935-245668957 CACTTTGGGTGATCTGAGGCAGG - Intronic
1063822928 10:9857938-9857960 ATGATTGGGTGCTCAGAAGCTGG - Intergenic
1064932508 10:20642899-20642921 CCCTGGGGGAGCTCTGAAGCTGG + Intergenic
1065590763 10:27259092-27259114 CCCCATGGGGGCTCTGCAGCCGG + Intergenic
1066422919 10:35278656-35278678 TCTATAGGGTGCTCTGGAGCTGG + Intronic
1067041802 10:42958050-42958072 CCCCCTGGGTGCTCTGGGGCAGG - Intergenic
1070963691 10:80516601-80516623 CCCATTGGGCCCTCTGGAGAGGG - Intronic
1071178531 10:82955940-82955962 CTCAGAGGGAGCTCTGAAGCTGG - Intronic
1073070655 10:100791172-100791194 CACAAAGGGTGCTTTGAAGCAGG - Intronic
1073704025 10:105961698-105961720 CTCACTGGGAGCTCTGGAGCTGG + Intergenic
1074975359 10:118576728-118576750 CCTACTGGTTGCTCTGAAGCTGG - Intergenic
1075118169 10:119644561-119644583 CCCAGAGGGCGCTCTGGAGCCGG + Intergenic
1075930669 10:126292593-126292615 CCCATTCAGTGCTCTAGAGCAGG + Intronic
1076051978 10:127342362-127342384 CCCATTGTGGGCTCTGAGGTTGG + Intronic
1076995278 11:294668-294690 CCCAGAGGGGGCTCTGGAGCGGG - Exonic
1077222113 11:1422351-1422373 CCCATGGGGTGCTCTGGGGAGGG + Intronic
1077325817 11:1963563-1963585 CCCACTGAGTGCCCTGAACCAGG - Intronic
1079362442 11:19780273-19780295 CCCAGTGGGTGCTTTGGACCTGG - Intronic
1079628285 11:22642842-22642864 CCCATTGCCTGCTCTGTAGTTGG + Intronic
1080217508 11:29862075-29862097 CCCAAAGGGAGCTCTGGAGCAGG + Intergenic
1080377671 11:31732893-31732915 CTATTTGGGTGCTCTGATGCTGG - Intronic
1081501386 11:43670075-43670097 TCCACTGGGAGCTCTGAAGCTGG + Intronic
1081742292 11:45449099-45449121 CCCCCAGGGAGCTCTGAAGCTGG - Intergenic
1084053889 11:66618532-66618554 CCTGCTGGGTGCTCTGAGGCAGG + Intronic
1085126934 11:74008367-74008389 CCCTGTGGTAGCTCTGAAGCAGG + Intronic
1086066940 11:82755357-82755379 CCCATGGGAAGCTCTGGAGCTGG - Intergenic
1088396662 11:109377043-109377065 CCCATGTGGAGCTCTGGAGCTGG - Intergenic
1090183973 11:124724168-124724190 CACAATGGGTCCTCAGAAGCTGG - Intergenic
1202808797 11_KI270721v1_random:18742-18764 CCCACTGAGTGCCCTGAACCAGG - Intergenic
1094201257 12:27796881-27796903 CTCTTTGGGTGGGCTGAAGCAGG - Intronic
1094270662 12:28610903-28610925 CCCATTGGGTGGTCTGACATAGG + Intergenic
1094354967 12:29567102-29567124 CCCATGGGGAGCTCTGGAACTGG - Intronic
1095698236 12:45164752-45164774 CCCACTGGGTGCTCTGACCCAGG + Intergenic
1097140658 12:56900153-56900175 CCCATTGTGTGCTCTGCCTCAGG - Intergenic
1098775946 12:74617717-74617739 CCCATTAAGAGCTCTGGAGCTGG - Intergenic
1101062382 12:100985710-100985732 CCCTTTGGGAGTTCTGAAGAAGG + Intronic
1103244151 12:119440766-119440788 CCCAAGGGCAGCTCTGAAGCTGG + Intronic
1108590063 13:51905441-51905463 CCCTTGGGTTGCTCTGAAGAAGG - Intergenic
1114397958 14:22383997-22384019 CTCATGGGCTTCTCTGAAGCAGG - Intergenic
1115508893 14:34120386-34120408 TCCAGAGGGAGCTCTGAAGCTGG - Intronic
1117005726 14:51419155-51419177 CACAGAGGGTGATCTGAAGCAGG - Intergenic
1117265093 14:54078475-54078497 CCCATAGGGAGTTCTGAAACTGG + Intergenic
1117507616 14:56418456-56418478 TCCACTGGGAGCTCTGAGGCTGG - Intergenic
1118683644 14:68269264-68269286 ACCACTGGTGGCTCTGAAGCAGG - Intronic
1119884441 14:78128732-78128754 CCCATTGGCAGCTATGAGGCTGG + Intergenic
1120921998 14:89763864-89763886 CCCATGGGGACCTCTGAAGATGG - Intergenic
1123449087 15:20349289-20349311 CCCAGTGGGTCCTCTGCAGCAGG - Intergenic
1126657162 15:50991007-50991029 CCCATGGGGAGCTCTGGAGCTGG + Intronic
1126820328 15:52496817-52496839 CCCATGAGGTGCTGTGAAACTGG + Intronic
1127292053 15:57579804-57579826 TCCATAGGGAGCTCTGGAGCAGG - Intergenic
1127702495 15:61514703-61514725 CCCATGGGGAGCTCTGGGGCTGG + Intergenic
1128258715 15:66216974-66216996 CCCATGGGGTGCTCTGGAGAAGG - Intronic
1129148707 15:73673143-73673165 CGCATGGGGCACTCTGAAGCTGG - Intergenic
1133448417 16:5882661-5882683 ACCATGGGGAGCTCTGGAGCAGG - Intergenic
1134015295 16:10883845-10883867 CCCATAGGGAGCACTCAAGCTGG + Intronic
1134107508 16:11494527-11494549 CCCACTGGGGGCACTGAAGCCGG + Intronic
1135474518 16:22762514-22762536 CCCATGGGGAGCTCTGGAGTTGG + Intergenic
1137022717 16:35445284-35445306 CCAATTGGTGGCTCTGAACCAGG + Intergenic
1137723705 16:50642775-50642797 CTCACTGGGGGCTCTGCAGCCGG - Intergenic
1137804534 16:51291508-51291530 TCCATGGGGACCTCTGAAGCTGG + Intergenic
1139351056 16:66336073-66336095 CCCATGGGAAGCTCTGGAGCTGG - Intergenic
1143727717 17:8860809-8860831 CACAATGGGGACTCTGAAGCCGG + Intronic
1144066525 17:11629410-11629432 CCCATAGGGTCTTCTGAAGACGG + Exonic
1147776603 17:42906324-42906346 CCCACAGCGAGCTCTGAAGCTGG + Intronic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1149316354 17:55442585-55442607 GCCATGGGAAGCTCTGAAGCTGG + Intergenic
1150094063 17:62357091-62357113 CACAGTGGGTGAGCTGAAGCAGG + Intergenic
1150485398 17:65539754-65539776 CCAATTAGATTCTCTGAAGCTGG + Intronic
1155712745 18:28903260-28903282 CCCACAGGGAGCTCTGAACCTGG - Intergenic
1159428053 18:68314634-68314656 CCCATTAGTTACTTTGAAGCCGG + Intergenic
1161660881 19:5545382-5545404 CAGAAAGGGTGCTCTGAAGCGGG - Intergenic
1163157569 19:15447874-15447896 CCCACTGGGTGGTATGGAGCTGG - Intronic
1163233078 19:16016763-16016785 ACCTATGGGTGCTCTGATGCTGG + Intergenic
1165148228 19:33745686-33745708 CCCACAGGGAGCTCTGGAGCTGG + Intronic
1166668693 19:44697230-44697252 CCCAGTACGTGCTCTGAGGCAGG + Intergenic
1167619329 19:50552206-50552228 CCCAGTGGGGGGTGTGAAGCTGG - Intronic
925372372 2:3356105-3356127 CCAATGGGGAGCTCTGGAGCCGG + Intronic
927291483 2:21408846-21408868 CCCACTGGGTGCTCAGGAGCTGG - Intergenic
927940606 2:27100908-27100930 CTCACTGGGTCCTCTGCAGCCGG + Exonic
928314264 2:30233521-30233543 AGCATTGGGTGCTGTGTAGCAGG + Intronic
929689479 2:44062466-44062488 CCCGTGGGGAGCTCTGAAGCTGG + Intergenic
931989666 2:67777216-67777238 GCCCTTGGGTGCTCTGCAGAGGG + Intergenic
932464006 2:71901828-71901850 CCCACAGGGAGCTCTGAAGCTGG - Intergenic
932951776 2:76302099-76302121 CCTATAGGGTATTCTGAAGCAGG - Intergenic
939743105 2:145935010-145935032 GATATTGGCTGCTCTGAAGCAGG + Intergenic
941748854 2:169114741-169114763 CCCATAGGACACTCTGAAGCTGG + Intergenic
941916723 2:170818106-170818128 CCCATTGGGCACTCAGCAGCCGG - Intronic
942541289 2:177017880-177017902 CCTAATGGGAGCTCTGGAGCTGG - Intergenic
943918792 2:193675253-193675275 TCCATGGGGAGCTCTGGAGCTGG - Intergenic
947114591 2:226755606-226755628 AAACTTGGGTGCTCTGAAGCTGG + Intronic
947624022 2:231608261-231608283 CCCAAGGGGAGCTCTGGAGCAGG - Intergenic
947633605 2:231668815-231668837 GCCAATGGGAGCTCTGAGGCAGG - Intergenic
948722765 2:239911914-239911936 CCCACTGGCAGCTCTGAATCTGG + Intronic
1170582789 20:17711582-17711604 CCCCTGGGGGGCTCTGGAGCCGG + Intronic
1170598772 20:17824948-17824970 CCCTGTGGGAGATCTGAAGCTGG - Intergenic
1171213065 20:23331695-23331717 CCCGCTGGGGGCTCTGGAGCAGG + Intergenic
1171303014 20:24080142-24080164 CCCACAGGGTGCTCTGGAGTTGG + Intergenic
1172638224 20:36424239-36424261 CCCATAGGGAGCTCTGGAACTGG + Intronic
1172649279 20:36491611-36491633 TGCATTTGGTTCTCTGAAGCTGG + Intronic
1174454187 20:50638096-50638118 ACCATGGGCTGCCCTGAAGCTGG - Intronic
1175489192 20:59367581-59367603 CCCATGGGGAGCTCTGGAGCTGG + Intergenic
1179553521 21:42158181-42158203 CCCACTGGGCTCTCAGAAGCCGG - Intergenic
1179902482 21:44401322-44401344 AGCACTGGGAGCTCTGAAGCTGG + Intronic
1180997852 22:19974309-19974331 CGCCCTGGGAGCTCTGAAGCGGG - Intronic
1181933060 22:26418211-26418233 CACATTGGGTCCTTTGAAGAGGG - Intergenic
1181980962 22:26766083-26766105 CCTATGGGGCGCTCTGAAACTGG - Intergenic
1182306256 22:29370927-29370949 CCCATTGGGCCCTCTGCAGAGGG - Intronic
1184371303 22:44083803-44083825 GCCATGGGGTGCACTGCAGCAGG + Intronic
1185053223 22:48564538-48564560 CCCACTGGGAGCTCTGAAAAAGG + Intronic
950362974 3:12462714-12462736 TCCCTTGGCTGCTCTGATGCTGG + Intergenic
950841126 3:15969583-15969605 GCCATCGGGAGTTCTGAAGCTGG + Intergenic
950848129 3:16034759-16034781 CCCATGAGGAACTCTGAAGCTGG - Intergenic
951569872 3:24050590-24050612 TCCTTTGGGAGCTCTGGAGCAGG + Intergenic
953036071 3:39211979-39212001 CCCAGAGGGAGCTCTGGAGCTGG + Intergenic
953135864 3:40181254-40181276 GCCATGGGGTGCTTTGGAGCTGG - Intronic
953502509 3:43451364-43451386 TTCATAGGGAGCTCTGAAGCTGG - Intronic
953551765 3:43908684-43908706 CCCCTTAGGAGCTCTGGAGCTGG - Intergenic
956012913 3:64850686-64850708 CCCATTGGAAGCTCTAGAGCTGG + Intergenic
960988764 3:123297093-123297115 CCTATGGGATGATCTGAAGCCGG + Intronic
963375393 3:144457610-144457632 CCCATGGGGTCCCCTGAGGCTGG - Intergenic
967099029 3:186200831-186200853 CCCATGGGATGTTCTTAAGCAGG - Intronic
967749882 3:193101591-193101613 CCCAGTGGGTGCTCTGAATGGGG - Intergenic
968068164 3:195770456-195770478 GCCATTGGGTGGGCTGAAGTGGG - Intronic
969809340 4:9635872-9635894 ACCCTGGGGTGCTCTGAAACTGG - Intergenic
969850030 4:9948684-9948706 CCCACAGGGAGCTCTGGAGCTGG - Intronic
969964296 4:10978077-10978099 CCCTTAGGGTGCTCTGAAGGTGG + Intergenic
975168150 4:71201235-71201257 CCCATCAGGAGCTCTGGAGCTGG + Intronic
976113687 4:81703588-81703610 CACATGGGGTGCTCTGAAAATGG - Intronic
978399633 4:108316850-108316872 TCCATGGGGAGTTCTGAAGCTGG + Intergenic
979724356 4:123942562-123942584 CCCATTTGCTGCTCTGTAGGTGG + Intergenic
979868740 4:125789695-125789717 CCCATTTTGTGCTGTGAAGTAGG - Intergenic
980202223 4:129670567-129670589 CCCTATGGGTGCTTTGGAGCTGG + Intergenic
980545186 4:134252186-134252208 CCCATTTGTTGCTCAGAAGCAGG + Intergenic
981586018 4:146303167-146303189 CCCATGGGGAACTCTGGAGCCGG - Intronic
981937562 4:150251815-150251837 CCCAGTGGGTGCTGAGAACCTGG - Intronic
982397204 4:154925531-154925553 CCCCTTGGGAGCTCTGACACAGG + Intergenic
982576157 4:157112660-157112682 GCCATTGGGAACTCTGAAGATGG + Intronic
983252952 4:165365456-165365478 CCCATTGGGTGCTCTGAAGCTGG + Intronic
985061960 4:186089013-186089035 CCCATGGGGAGCTCTGGAGCTGG + Intergenic
985085505 4:186308748-186308770 CCCAAAGGGTGCTCTGGAACTGG + Intergenic
986452721 5:7882185-7882207 CCCACAGGGTTCTCTGGAGCTGG + Intronic
987669720 5:20990875-20990897 GCAATTGAGTGCTCTGAACCAGG - Intergenic
990633061 5:57691810-57691832 CCCACAGGGAGCTCTGAAGCTGG - Intergenic
991635499 5:68700209-68700231 CCCATGGGGAGATCTGAAGCTGG - Intergenic
994787016 5:104178860-104178882 CCCATTGGGTGGTCAGAGGTTGG - Intergenic
995495102 5:112733495-112733517 ACCATTGCTTGCTCTGAAGATGG + Intronic
995618865 5:114000466-114000488 GGCATGGGGTGCTCAGAAGCAGG + Intergenic
996272282 5:121621025-121621047 CCCACTGTGTGCTCTGACACTGG + Intergenic
996319458 5:122198160-122198182 TCCATGGAGTGCCCTGAAGCTGG - Intergenic
997225569 5:132207366-132207388 TCCATAGGATGCTATGAAGCTGG - Intronic
998570625 5:143253682-143253704 CCCATTGGGCGGTCGGAAGCTGG + Intergenic
999736700 5:154518358-154518380 CCCATTGGCTGGGGTGAAGCTGG + Intergenic
999928462 5:156405230-156405252 AGAATTGGGTGCTCTGAAGAGGG - Intronic
1001032948 5:168276080-168276102 CCCATGGTGAGCTCTGGAGCTGG - Intergenic
1004490665 6:16111833-16111855 CCCCATGGGAGCTCTGATGCTGG - Intergenic
1004820575 6:19364071-19364093 CCCATGGGGAGCTCTGAAGCTGG + Intergenic
1005964113 6:30714480-30714502 CCAATTGTGTGCTCTGGAGATGG - Intronic
1006202099 6:32302934-32302956 ACCATTGGTGGCTCTTAAGCAGG - Intronic
1007162206 6:39800771-39800793 CCCACAGGGAGCCCTGAAGCTGG - Intronic
1009218344 6:60950400-60950422 CGCAGTGGGAGCACTGAAGCAGG - Intergenic
1011557210 6:88583761-88583783 CCCATTGGGTGCTGTGACTGTGG - Intergenic
1013384070 6:109606753-109606775 TCCCTTGGGTGCTCCGTAGCCGG + Intronic
1014963486 6:127716535-127716557 CCCATAGGGAGATCTGGAGCTGG - Intronic
1017595282 6:156021712-156021734 CCCACAGGGAGTTCTGAAGCTGG + Intergenic
1018681950 6:166271833-166271855 CCCATGGGATGCACCGAAGCGGG - Intergenic
1020211946 7:6164264-6164286 CCCCTTGGGTGCTGTGTAGATGG + Exonic
1021229128 7:18064308-18064330 CCCATGGGGAGCTCTGAAGCTGG - Intergenic
1021370065 7:19833704-19833726 ATCATGGGGAGCTCTGAAGCTGG + Intergenic
1023521288 7:41052573-41052595 CCTATTGTGTGCTCAGAACCTGG + Intergenic
1023984653 7:45087804-45087826 ATCACTGGGTGCCCTGAAGCTGG + Intronic
1024010185 7:45260241-45260263 CCCAATGGGTGCGCTGAGGGTGG + Intergenic
1024227233 7:47335256-47335278 CCCATTTGGGGCCCTCAAGCGGG - Intronic
1024511021 7:50205116-50205138 CCCATTCTGTGCTCTGCTGCAGG - Intergenic
1026151131 7:67788905-67788927 TCCCGTGGGTGCTCCGAAGCAGG - Intergenic
1028251937 7:88547243-88547265 CCCATTGGGTGGTCGGAGGCTGG + Intergenic
1029927711 7:104335089-104335111 CTGATGGGGTGCTCTGAAGAGGG + Intronic
1033303742 7:140209270-140209292 CCCACAGGGAGCTCTGGAGCTGG + Intergenic
1034460390 7:151194815-151194837 CCCAGTGGGTGCTCTGTAAGAGG + Intronic
1034706733 7:153152447-153152469 TCCACTGGGAGCCCTGAAGCTGG + Intergenic
1034882320 7:154772077-154772099 CTCAGAAGGTGCTCTGAAGCTGG + Intronic
1034990458 7:155544722-155544744 CCCACTGGCTGCTCTGCTGCAGG - Intergenic
1037178405 8:15974077-15974099 CCCATGGGGAGCTCTAAAGTTGG + Intergenic
1039007844 8:33060494-33060516 CCCACAGGGAACTCTGAAGCAGG - Intergenic
1040512340 8:48106188-48106210 TCCCTGAGGTGCTCTGAAGCTGG + Intergenic
1042356479 8:67833995-67834017 CCCATTGTGTACCCTAAAGCAGG + Intergenic
1043371513 8:79599332-79599354 CCTATGGAGAGCTCTGAAGCTGG + Intergenic
1045226810 8:100255679-100255701 CTAATTAAGTGCTCTGAAGCTGG + Intronic
1046402279 8:113719492-113719514 CCCATGGGTTGATCTGCAGCAGG + Intergenic
1047132521 8:122037041-122037063 CCCATGGAGGGCTCTGGAGCTGG + Intergenic
1049235101 8:141508329-141508351 CCCACTGGGGGCAGTGAAGCCGG + Intergenic
1055395398 9:75868741-75868763 CCCATGGGGAGCTCTGAAGCAGG + Intergenic
1058918043 9:109586583-109586605 GCCATGGGGACCTCTGAAGCTGG + Intergenic
1059466068 9:114469614-114469636 CCCACAGGGAGCTCTGGAGCTGG - Intronic
1062504240 9:136865330-136865352 CTCATGGGGTCCCCTGAAGCAGG + Intronic
1062719033 9:138025239-138025261 CCCAGTGGCTGCTGTGGAGCAGG - Intronic
1185686407 X:1932520-1932542 CCCATTGTATGCTCTATAGCTGG - Intergenic
1186671227 X:11769441-11769463 CCCATTAGGTGATCTGTAGGTGG + Intronic
1187077334 X:15948130-15948152 CCTTCTGGGTGCTCTGAAGGAGG + Intergenic
1187258406 X:17661940-17661962 CCCATGGGGAGCTCTAGAGCTGG - Intronic
1187847586 X:23556769-23556791 CTCAGTGGGTGCTCTTAATCTGG + Intergenic
1189359711 X:40340511-40340533 CCCATGGGGAGTTCTGGAGCTGG + Intergenic
1192390254 X:70718858-70718880 CTTATTGGGAGCTCTGAAGCTGG - Intronic
1193583645 X:83294444-83294466 CCCATTGGGTGCTCTATCCCAGG - Intergenic
1194837561 X:98699413-98699435 CCCAGAGGGTGAGCTGAAGCAGG - Intergenic
1196601168 X:117603296-117603318 CCCATTGGGAGCTCTGTCTCAGG - Intergenic
1200060354 X:153481177-153481199 CCAAATGGGGGCTCTGAGGCTGG - Intronic