ID: 983253880

View in Genome Browser
Species Human (GRCh38)
Location 4:165377168-165377190
Sequence GTAAAATCATGCCTACTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983253880_983253882 30 Left 983253880 4:165377168-165377190 CCACATAGTAGGCATGATTTTAC 0: 1
1: 0
2: 1
3: 12
4: 119
Right 983253882 4:165377221-165377243 ATTTTTTAAATCCAGCAATCAGG 0: 1
1: 0
2: 3
3: 37
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983253880 Original CRISPR GTAAAATCATGCCTACTATG TGG (reversed) Intronic
902991836 1:20193200-20193222 ATAAAATCACACCTACTCTGTGG + Exonic
904979332 1:34483799-34483821 GTAAAAGCAGGCATACTCTGAGG + Intergenic
906796375 1:48699296-48699318 GGACAATAATGCCTACTTTGTGG + Intronic
908935116 1:69366194-69366216 GTAAAATCATTCCTTTTATGTGG + Intergenic
916670258 1:167011129-167011151 TTAAAATCATTCTTACAATGAGG - Intronic
919890523 1:201970458-201970480 CTAACATCATGCCTCCTATAGGG - Exonic
920939095 1:210464262-210464284 GTAAAAGCATGACTCCTAAGAGG + Intronic
921025341 1:211274235-211274257 GGAAAAGCATGGCTACAATGTGG + Exonic
1065598416 10:27341729-27341751 ATACAATCATGCCTACTTTGTGG + Intergenic
1078179424 11:8998469-8998491 GTAAAATTCTTCCTACTCTGAGG + Intronic
1078473751 11:11612785-11612807 GAAAAATGATGCCTACAAGGAGG - Intronic
1079876798 11:25868333-25868355 GTAAAATCATGCAAACAAAGCGG - Intergenic
1081446821 11:43138813-43138835 GTGAAATCAGCCCTACTTTGTGG - Intergenic
1081604129 11:44516587-44516609 ATAAAATAATGCCTCCTAAGAGG - Intergenic
1086074050 11:82831238-82831260 GTAAAATAATGCCTACAAGTTGG + Intronic
1088354769 11:108931228-108931250 GTAAGATCATGCCCACCATGGGG + Intronic
1092445571 12:8553511-8553533 ACAAAATCATGCCTCATATGAGG - Intergenic
1093768459 12:22992657-22992679 CTAAAATCATCCCAAATATGGGG - Intergenic
1097348537 12:58521965-58521987 GTAAAATCCTGACTAATACGAGG - Intergenic
1100818772 12:98411508-98411530 GTAGAAACATGCCAATTATGGGG + Intergenic
1100909673 12:99344613-99344635 ATAAAATCTTGCCTACTTTTGGG + Intronic
1105224132 13:18412648-18412670 GTACAATTATGCCTACTTTGTGG - Intergenic
1106965035 13:35053858-35053880 GAATAATAATGCCTACTTTGTGG - Intronic
1106998209 13:35512910-35512932 GAAAAATCAATCCTACCATGAGG - Intronic
1108238736 13:48438269-48438291 GAAAAATAATGCTTACTATAGGG - Intronic
1110723117 13:78787967-78787989 GAATAATCATGTCTACCATGAGG + Intergenic
1112544686 13:100354639-100354661 GTAAAATCATGAATAATAGGGGG + Intronic
1112940215 13:104853032-104853054 ATAAAAACATGCATACTAAGTGG - Intergenic
1114073881 14:19140280-19140302 GAATAATAATGCCTACTTTGTGG - Intergenic
1114088385 14:19259693-19259715 GAATAATAATGCCTACTTTGTGG + Intergenic
1114753403 14:25230906-25230928 GTAAAATGATGCATAATATAGGG - Intergenic
1119862404 14:77945963-77945985 CTCAAATCCTGCCTTCTATGGGG + Intergenic
1124101845 15:26703118-26703140 GTAAAATGATGCTTATTAGGAGG - Intronic
1127358368 15:58223578-58223600 GTAAAATCATTCCTCCTTTCAGG + Intronic
1132014138 15:98300965-98300987 TTAAAAACATTCCCACTATGGGG + Intergenic
1133607752 16:7404958-7404980 GTAAAATCATCTCTACTAGAGGG - Intronic
1136717457 16:32293895-32293917 ATAAAATCATGCAGAATATGAGG + Intergenic
1136835832 16:33500158-33500180 ATAAAATCATGCAGAATATGAGG + Intergenic
1203008971 16_KI270728v1_random:223879-223901 ATAAAATCATGCAGAATATGAGG - Intergenic
1203146008 16_KI270728v1_random:1800491-1800513 ATAAAATCATGCAGAATATGAGG + Intergenic
1146010044 17:29186632-29186654 GTAAGATGATGCCTATCATGTGG + Intergenic
1149270316 17:54969679-54969701 GTATAATTATCCCCACTATGTGG + Intronic
1154474278 18:14739759-14739781 ATAAAATCATGCAGAATATGAGG + Intronic
1154529175 18:15326483-15326505 GTACAATTATGCCTACTTTGTGG + Intergenic
1157582341 18:48780939-48780961 GAAAAATCATGCCAGCTAGGAGG - Intronic
1158451326 18:57568281-57568303 CTCAAATCATGCATACTAAGAGG + Intronic
1167459444 19:49616577-49616599 CTCAAATCTTGCCTATTATGAGG - Intronic
927846621 2:26475631-26475653 TTAAAATCAAGGCTAATATGAGG + Intronic
930328754 2:49955551-49955573 GTAAGATAAAGCCTACTCTGTGG + Intronic
933021982 2:77205728-77205750 GAAAAATCATGACTATCATGAGG + Intronic
933541058 2:83643355-83643377 TTAAAATAATGCATACTTTGTGG - Intergenic
936551495 2:113446019-113446041 GAAAACCCATGCCTACTATAAGG - Intronic
936558422 2:113515757-113515779 GTGAAATCAACCCTACTTTGTGG + Intergenic
936961108 2:118075651-118075673 GTAAAATCATTGCTGATATGTGG + Intergenic
938487812 2:131731668-131731690 GAATAATAATGCCTACTTTGTGG - Intronic
938528278 2:132157897-132157919 GTACAATTATGCCTAATTTGTGG + Intronic
939554290 2:143655579-143655601 CTAAAATCAACTCTACTATGGGG - Intronic
942135430 2:172920343-172920365 GGAAAATCATGCCAGCTATTAGG - Intronic
942369744 2:175270919-175270941 ATAAATTCCTGCCTACTTTGAGG + Intergenic
942902749 2:181142232-181142254 CTAAAATAATGCCTGCAATGTGG + Intergenic
943616628 2:190100289-190100311 CTGAAATCATGCTGACTATGTGG + Intronic
945001963 2:205361342-205361364 GTAAATTTATGTCTACTATGGGG - Intronic
946266618 2:218548641-218548663 GTAAAATATTTCTTACTATGCGG - Intronic
1169149771 20:3280244-3280266 GTAAAAGAATGCTTACTGTGTGG - Intronic
1171968091 20:31545611-31545633 GTAAAAAAATGCAAACTATGGGG + Intronic
1172949676 20:38714779-38714801 GTAAACTCCTGCCCACTGTGGGG - Intergenic
1173713052 20:45176986-45177008 GTAACATCATCCTTTCTATGTGG - Intergenic
1174964722 20:55199501-55199523 GTAAAATCATGCCAACAAGAAGG + Intergenic
1175003870 20:55661553-55661575 CTAAACCCAAGCCTACTATGTGG + Intergenic
1175781132 20:61682691-61682713 GTAAAATCATTCCTGGCATGGGG - Intronic
1176768223 21:13042004-13042026 GTAAAATTATGCCTACTTTGTGG - Intergenic
1177296443 21:19182433-19182455 GGAAAATCATGCCATTTATGGGG - Intergenic
1180492328 22:15862644-15862666 GAATAATAATGCCTACTTTGTGG - Intergenic
1180515353 22:16136232-16136254 GTACAGTTATGCCTACTTTGTGG - Intergenic
1180558359 22:16595678-16595700 GGAACATCAAGCCTACTCTGAGG - Intergenic
949184887 3:1178692-1178714 GTAAAAACATGCCTATTCTTAGG - Intronic
953000698 3:38930724-38930746 GTAAAACCATGCCCACCAGGAGG + Intronic
956970010 3:74511911-74511933 GAAAGATCATGTCTACTAGGAGG + Intronic
958881123 3:99671607-99671629 GTAAAATAGTGGTTACTATGGGG - Intronic
969515958 4:7648410-7648432 GTGACATCAGGCCTACTCTGAGG - Intronic
976694873 4:87908699-87908721 GTAAAGTCAGCTCTACTATGAGG + Intergenic
977459374 4:97306093-97306115 TTAAAATCATGCATACCTTGTGG - Intronic
981490385 4:145333280-145333302 GCAAAATCATGCTTTTTATGGGG - Intergenic
982957416 4:161789677-161789699 GTAAAATCATGACTATCATGTGG - Intronic
983253880 4:165377168-165377190 GTAAAATCATGCCTACTATGTGG - Intronic
984682988 4:182632340-182632362 TTTAAAACATGCCTACTCTGTGG - Intronic
987590076 5:19913176-19913198 TTATAATCATGACTAATATGAGG - Intronic
989433060 5:41377788-41377810 TTAAAATCATGCCTAATATTTGG - Intronic
992986100 5:82231589-82231611 ATAAAAACCTGGCTACTATGAGG - Intronic
999104536 5:149059190-149059212 GTAAAATCATGACTCCTCTCTGG - Intronic
1004589825 6:17039379-17039401 ATAAAATGATACCAACTATGTGG - Intergenic
1005227856 6:23663832-23663854 ATCAAATCATGCCTACCATTAGG + Intergenic
1008420961 6:51298685-51298707 CTAAAATCATACCTAATAAGTGG + Intergenic
1009629292 6:66173282-66173304 GTAAAAAAATTCCTAATATGAGG - Intergenic
1009718554 6:67432133-67432155 GTAAACTCATGCCAACTATCTGG + Intergenic
1010925920 6:81745939-81745961 CTACAATCATGCCTGCTTTGAGG - Exonic
1011974606 6:93280783-93280805 TTAAAATCATTCCTAGCATGTGG + Intronic
1012307552 6:97677276-97677298 GCCTAATCATCCCTACTATGTGG + Intergenic
1013873295 6:114794126-114794148 GAAAAATCATGACTAATAAGAGG - Intergenic
1017361298 6:153575248-153575270 GTTAAATCATGTCTATCATGAGG - Intergenic
1018974219 6:168552720-168552742 ATAAAATCATGCCTCCTGTGGGG + Intronic
1019201135 6:170316750-170316772 GTAAAACCATGACCACTAAGTGG + Intronic
1022993946 7:35734366-35734388 TTAAAAGCATGCCAACAATGAGG + Intergenic
1025628880 7:63249654-63249676 GTAAAATGGTGGCTACTCTGGGG + Intergenic
1025653383 7:63494440-63494462 GTAAAATGGTGGCTACTCTGGGG - Intergenic
1031180387 7:118407257-118407279 ATAAAATCATGACTTCTATACGG + Intergenic
1034618957 7:152442331-152442353 GGAACATCAAGCCTACTCTGAGG + Intergenic
1038032675 8:23657240-23657262 GTAAAATGATGCACACTCTGTGG - Intergenic
1041472158 8:58222802-58222824 GTAAAATAATGCTCACTATTTGG + Intergenic
1041495586 8:58482113-58482135 GTAGAATCATGGTTACTAGGTGG - Intergenic
1043165091 8:76893584-76893606 TTAAAACCATGCCAACTAGGAGG - Intergenic
1044199473 8:89416306-89416328 GTAAAATCATGACTCTCATGTGG + Intergenic
1046323922 8:112615400-112615422 GTAATATCATGACTACTCTATGG - Intronic
1049894443 9:100510-100532 GTGAAATCAACCCTACTTTGTGG - Intergenic
1049901504 9:171109-171131 GAAAACCCATGCCTACTATAAGG + Intronic
1049984617 9:937430-937452 GTAAAATCATGCTGACACTGTGG - Intronic
1049984835 9:940118-940140 GTAAAATCATGCTGACACTGTGG + Intronic
1051963699 9:22800664-22800686 GTTAAATTATGGTTACTATGTGG - Intergenic
1053706891 9:40764227-40764249 GTACAATTATGCCTACTTTGTGG + Intergenic
1053735653 9:41100502-41100524 GTGAAATCAACCCTACTTTGTGG - Intergenic
1053744537 9:41181404-41181426 GAAAACCCATGCCTACTATAAGG + Intronic
1054349805 9:64011297-64011319 GAAAACCCATGCCTACTATAAGG + Intergenic
1054416805 9:64884993-64885015 GTACAATTATGCCTACTTTGTGG + Intergenic
1054683808 9:68249846-68249868 GAAAACCCATGCCTACTATAAGG - Intronic
1054692727 9:68330898-68330920 GTGAAATCAACCCTACTTTGTGG + Intronic
1055516594 9:77040001-77040023 TAAAAATAATGCCTACTGTGTGG - Intergenic
1059674641 9:116526278-116526300 GAATAATCATACCTACTCTGTGG + Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1188402853 X:29769185-29769207 ATAAAATAATTCCTACAATGTGG - Intronic
1188846470 X:35077919-35077941 GTACAATCTTGCCATCTATGTGG - Intergenic
1196482824 X:116169670-116169692 CTAAAATCATGCCTAGCATATGG - Intergenic
1197977950 X:132185158-132185180 GTAAAAACATGACTTCTTTGGGG - Intergenic
1199812052 X:151359773-151359795 ATAAAGTCATGCCAAATATGAGG - Intergenic