ID: 983254626

View in Genome Browser
Species Human (GRCh38)
Location 4:165384076-165384098
Sequence GCCCCGTGGTAAGACGGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983254626_983254632 30 Left 983254626 4:165384076-165384098 CCCTTACCGTCTTACCACGGGGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 983254632 4:165384129-165384151 TACAAAATAGCTCTTGTAACGGG 0: 1
1: 0
2: 0
3: 11
4: 159
983254626_983254631 29 Left 983254626 4:165384076-165384098 CCCTTACCGTCTTACCACGGGGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 983254631 4:165384128-165384150 ATACAAAATAGCTCTTGTAACGG 0: 1
1: 0
2: 1
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983254626 Original CRISPR GCCCCGTGGTAAGACGGTAA GGG (reversed) Intronic
911076308 1:93878915-93878937 GCCCCGTGCTAAGCCTGTCACGG - Intronic
1063626549 10:7695729-7695751 GCTCTGAGGCAAGACGGTAATGG + Intergenic
1065880599 10:30034430-30034452 GCCCGGTGTTAAGACAGTACAGG - Intronic
1067031895 10:42883899-42883921 GGCCCGAGGAAAAACGGTAATGG + Intergenic
1069705918 10:70458956-70458978 GCACCGCGGTAAGGCGGTGATGG - Intergenic
1074323142 10:112422049-112422071 GCCCTGTGGTCAGACAGTCATGG + Intronic
1080937997 11:36883316-36883338 TCCTTGGGGTAAGACGGTAAAGG - Intergenic
1088265074 11:107980884-107980906 ACCCCGAGGTAGGACGGTAAGGG - Intergenic
1093049008 12:14485624-14485646 CCCCTGAGGTAAGACAGTAAAGG + Intronic
1093049756 12:14491633-14491655 CCCCTGAGGTAAGACAGTAAAGG + Intronic
1113067002 13:106382778-106382800 GCCCAGGGGTAAGACGGGGAAGG + Intergenic
1113460182 13:110476800-110476822 GCCCAGTGGTCAGACACTAAGGG - Intronic
1117571904 14:57056756-57056778 GCCCCGTGGTAAGGCAGCTAAGG + Intergenic
1126954816 15:53921076-53921098 GCCCTGTGGTAGGAGGGGAAAGG + Intergenic
1140907141 16:79418519-79418541 GCCCCGTGGTGAGGGGGCAAAGG + Intergenic
1141446071 16:84059262-84059284 GCCCCGTGGAAAGAGTGGAAGGG + Intronic
1156682731 18:39610521-39610543 CCCCTGTGGTAACAGGGTAATGG + Intergenic
1159534013 18:69692109-69692131 TCACCGTGGAAAGACGGTGATGG + Intronic
1160092373 18:75839340-75839362 CCCCCGAGGTAGGACAGTAAAGG - Intergenic
1167402581 19:49282710-49282732 TCCCCGCGGCAAGACAGTAAAGG - Intergenic
940606012 2:155925031-155925053 ACCCTGTGGTAGGACAGTAAAGG + Intergenic
948461006 2:238129996-238130018 GCCCCAAGGTAAGACTTTAAAGG - Intronic
1183859474 22:40659174-40659196 GTCCCGAGGCAAGATGGTAAAGG + Intergenic
950936173 3:16841974-16841996 GCCCAGTGGTCAGAGGGAAATGG + Intronic
956306783 3:67834950-67834972 GCCCTGAGGTAGGACAGTAAAGG - Intergenic
969416857 4:7066513-7066535 CCCCCATGGCAAGACTGTAATGG - Intronic
969707298 4:8818948-8818970 GCCTCTTGGTAAGAAGGTAGAGG + Intergenic
972345025 4:38185557-38185579 GCCCTGTGGTAAGATGGGAGGGG + Intergenic
975982703 4:80177943-80177965 CCCCTGTGGTAGGACAGTAAAGG + Intergenic
983254626 4:165384076-165384098 GCCCCGTGGTAAGACGGTAAGGG - Intronic
987657222 5:20822327-20822349 TCCCTGTGGTAGGACAGTAAAGG + Intergenic
988766325 5:34381621-34381643 TCCCTGTGGTAGGACAGTAAAGG - Intergenic
997653591 5:135539347-135539369 ACCCAGTGGAAAGAGGGTAAGGG + Intergenic
997840389 5:137234260-137234282 GCCCCAGGGTAAGAGGCTAAGGG - Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003695991 6:8406813-8406835 ACCCCGAGGTAGGACAGTAAAGG + Intergenic
1008820306 6:55624478-55624500 CCCCTGTGGTAGGACAGTAAAGG - Intergenic
1033174995 7:139115611-139115633 GCCCTGTGGCAAAACTGTAAAGG + Intergenic
1033362473 7:140647300-140647322 TCCCCGTGGTAAGCCAGCAAAGG - Intronic
1038733028 8:30144549-30144571 GCCCCCTGGTAAAACGATATAGG + Exonic
1044774675 8:95675891-95675913 GCCCTGAGGTAGGACAGTAAAGG - Intergenic
1048998004 8:139806126-139806148 GCCGCGTGGGATGATGGTAAGGG - Intronic
1050601717 9:7259619-7259641 GCTCCGTGGTAAGAAGGAGAAGG + Intergenic
1056771376 9:89480558-89480580 GCCCCGTGGGAAGGCAGTCAAGG + Intronic
1185802879 X:3029387-3029409 GACACGTGGAAAGACGATAAGGG + Intronic
1191630121 X:63313263-63313285 CCCCTGAGGTAAGACAGTAAAGG + Intergenic
1191932861 X:66393494-66393516 ACCCTGTGGTATGACAGTAAAGG - Intergenic
1193832860 X:86309438-86309460 CCCCTGTGGTAGGACAGTAAAGG - Intronic
1198933948 X:141887213-141887235 CCCCTGAGGTATGACGGTAAAGG - Intronic
1199024293 X:142919055-142919077 CCCCTGAGGTAGGACGGTAAAGG - Intergenic