ID: 983261822

View in Genome Browser
Species Human (GRCh38)
Location 4:165465343-165465365
Sequence ATTTATTTACAGAAATTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 573}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983261822 Original CRISPR ATTTATTTACAGAAATTGGC TGG (reversed) Intronic
900358570 1:2276610-2276632 ATTTGTAAACAGAAAATGGCAGG + Intronic
900665175 1:3810438-3810460 ATATATATACAAAAATTAGCTGG + Intergenic
900757532 1:4447012-4447034 ATTTATTTACAAAACTGGGCAGG - Intergenic
901120801 1:6891742-6891764 ATTTATGTATTAAAATTGGCTGG - Intronic
901299442 1:8188791-8188813 ATTTATTTAGAGAAAGGGTCTGG + Intergenic
901407896 1:9062108-9062130 ATTTGTTTAATGAAGTTGGCTGG - Intronic
901570715 1:10158018-10158040 ATTAATTTACAGAAATTCTATGG - Intronic
901581788 1:10250498-10250520 CTGTATTTACAAAAATTAGCTGG - Intronic
901675224 1:10879493-10879515 ATATATATACAAAAATTAGCTGG + Intergenic
901909837 1:12447561-12447583 ATTTATTTAAAGAAATAGTTGGG + Intronic
903436474 1:23353750-23353772 ATTTTTTTGAAAAAATTGGCTGG - Intergenic
904543186 1:31247889-31247911 ATATATATACAAAAATTAGCTGG - Intergenic
905995033 1:42374360-42374382 AATTATTTAAAAAAATTAGCTGG + Intergenic
906501675 1:46345851-46345873 ATTTATTAAAAAATATTGGCCGG + Intronic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907331048 1:53671927-53671949 ATTTATTAACAAGAATTGACTGG + Intronic
907944296 1:59119819-59119841 ATATATGAACAGAAATTGGCTGG - Intergenic
908677993 1:66627670-66627692 AATTATTTAGAAAAATTTGCAGG - Intronic
908848264 1:68347219-68347241 ATATATATACAAAAATTAGCCGG - Intergenic
909239951 1:73199796-73199818 ATTTCTTTATAGACATTTGCTGG - Intergenic
910312598 1:85841784-85841806 AATTATTTAAAGAAATTGTAAGG - Intronic
910375955 1:86570849-86570871 ATTTATTTAAAGGAATTCGGTGG - Intronic
910820933 1:91345395-91345417 ATGTAGTTAGAGAAATAGGCAGG + Intronic
911278236 1:95890954-95890976 ATTTATTTTCCCAAGTTGGCAGG + Intergenic
911408897 1:97477076-97477098 TCTTGTTTACAGAAATTGCCAGG - Intronic
911438522 1:97895127-97895149 CTTGCTTTACAGAAATTGCCTGG + Intronic
911667884 1:100574850-100574872 AGTATATTACAGAAATTGGCAGG - Intergenic
911937551 1:103998085-103998107 ATATATTTACAGAAATTTGGAGG + Intergenic
912070968 1:105809061-105809083 GTTTATTTACATAAATAGACTGG - Intergenic
912944595 1:114074663-114074685 ATATATGCACAGAAGTTGGCAGG + Intergenic
912996159 1:114534438-114534460 ATTTTTTTAAAAAATTTGGCCGG + Intergenic
914337871 1:146732158-146732180 ATTTACTTACAGACACAGGCAGG - Intergenic
914504727 1:148279028-148279050 ATTTTTCTTCAGAAATTGGCTGG - Intergenic
914507912 1:148305366-148305388 ATTTTTCTTCAGAAATTGGCTGG + Intergenic
914738138 1:150438126-150438148 ATATATATACAAAAATTAGCCGG + Intronic
915032224 1:152891038-152891060 ATTTAGTTTTAGAAATTGACAGG - Intergenic
915153730 1:153857146-153857168 ATATATATATATAAATTGGCCGG + Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916591188 1:166192270-166192292 AAATATATACAGAAATTAGCTGG + Intergenic
916607070 1:166353593-166353615 AGATGTTTAAAGAAATTGGCAGG + Intergenic
917338610 1:173950872-173950894 ATTTTTTTAAAAAAATTAGCTGG + Intronic
917783918 1:178431807-178431829 ATTCATTTACATAAATGGGATGG - Intronic
918586259 1:186192499-186192521 CTTTATTTACAAAATCTGGCTGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919544558 1:198898674-198898696 ATTTATGTACAGAATTTGGTTGG + Intergenic
919959680 1:202453818-202453840 ATTTCTTTACATAAAATGGAAGG + Intronic
919976765 1:202617850-202617872 TTTTATTTACAAAAATTAGGTGG - Intronic
921231112 1:213072384-213072406 ATTTTTATACAAAAATTAGCTGG + Intronic
921397540 1:214684482-214684504 ATTTATTTAGAAAAATGGGTGGG - Intergenic
921537467 1:216369759-216369781 ATATATATACAAAAATTAGCTGG + Intronic
921647209 1:217632794-217632816 ATTTATTTAGAGTATGTGGCAGG + Intronic
923305938 1:232688166-232688188 CTTGATTTTCAGAAACTGGCTGG - Intergenic
923704196 1:236330309-236330331 ATATATTTAAAAAAATTAGCTGG - Intergenic
923743359 1:236676677-236676699 ATTTTTTTAAAAAAATTAGCTGG - Intergenic
923913273 1:238473145-238473167 ATTTATCTAAAGAAAGTAGCTGG - Intergenic
924392232 1:243574985-243575007 ATATATTTATAGAAATTGGCTGG - Intronic
924545580 1:245023871-245023893 ATTAATATATAAAAATTGGCTGG + Intronic
1063567845 10:7187480-7187502 GTTTATTTGCAGAAAATGGCAGG - Intronic
1063781365 10:9328945-9328967 ACTTCTTTGCAGAAATTGACAGG + Intergenic
1064093104 10:12402055-12402077 ATATATATACAAAAATTAGCTGG - Intronic
1064195526 10:13241135-13241157 ATATATTTTTAGAAATTAGCCGG + Intergenic
1064553603 10:16526216-16526238 ATATATATACAAAAATTAGCTGG - Intergenic
1065255646 10:23864756-23864778 ATTTATTTTAAGAAATTGACTGG + Intronic
1065429337 10:25637928-25637950 CTTAATATACAGAAATAGGCCGG + Intergenic
1065539639 10:26749755-26749777 CTTTATTTACAAAAATTGCGTGG - Intronic
1066199087 10:33128337-33128359 ATATATATACAAAAATTAGCTGG - Intergenic
1066377535 10:34870976-34870998 CTTTATTTTTAGAAATTGGCAGG + Intergenic
1066573835 10:36803211-36803233 TTTTATTTGCAGAAATTTGGAGG - Intergenic
1066601922 10:37118381-37118403 ATATATTTATAGAAAATGTCTGG - Intergenic
1066635831 10:37498644-37498666 ATATATATACAGAAATTCTCTGG - Intergenic
1066754610 10:38698197-38698219 TTTTATTTATAAAAATAGGCTGG - Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067680586 10:48435611-48435633 ATTTAGTTACAAGAATTGGTAGG + Exonic
1067795798 10:49320735-49320757 ATTTATTTTAAGGAACTGGCTGG + Intronic
1068218880 10:54017622-54017644 ATTAATAGACAGAAATTGGGTGG + Intronic
1068278476 10:54834792-54834814 ATTCATTTTCACAAATAGGCAGG - Intronic
1068735177 10:60406261-60406283 CTTTATTTACAAAAACAGGCAGG + Intronic
1069389118 10:67913849-67913871 ATGTATTTACAGCAAATGACTGG - Intronic
1069798353 10:71067407-71067429 ATTTATATAGATAAATCGGCCGG + Intergenic
1069835623 10:71306234-71306256 ATTTAAATACAAAAATTAGCTGG - Intergenic
1070000093 10:72369868-72369890 ATATATGTACAAAAATTAGCCGG - Intronic
1074095666 10:110309900-110309922 TTTTATTTATATGAATTGGCTGG - Intergenic
1074098543 10:110334716-110334738 ATATATTTAAAAAAATTAGCTGG + Intergenic
1074824927 10:117207832-117207854 ATTAATTTACATAATTGGGCTGG + Intronic
1075162997 10:120041123-120041145 ATATATATACAAAAATTAGCTGG - Intergenic
1075329542 10:121563386-121563408 ATATATATACATAAATTAGCCGG + Intronic
1075397706 10:122139919-122139941 ATTTCATTTCAGAGATTGGCTGG - Intronic
1077661486 11:4072351-4072373 ATTTATTCACATAAATTATCAGG - Intronic
1078936430 11:15955167-15955189 ATTTATTTAAAGATATTGTACGG + Intergenic
1079198137 11:18349188-18349210 ATTAAGTTACTGAAATAGGCTGG - Intronic
1079378574 11:19916796-19916818 TTTTATTTACAAAAATAGGTGGG + Intronic
1080153795 11:29084144-29084166 ATTTATTTAAAAAAATTAGTTGG - Intergenic
1080654809 11:34250495-34250517 ATTTATTGACATCAAATGGCAGG + Intronic
1081240311 11:40697771-40697793 GTTATTTTACAAAAATTGGCCGG + Intronic
1081791965 11:45794511-45794533 ATTTCTTTGCATAACTTGGCTGG - Intergenic
1081986985 11:47312408-47312430 ATGTATATACAAAAATTAGCTGG - Intronic
1082035728 11:47643900-47643922 ATTGAAATACAGATATTGGCTGG + Intergenic
1082092664 11:48102562-48102584 ATATATATACAAAAATTAGCTGG - Intronic
1082220848 11:49634239-49634261 ATTTATTTTCATAATTTGCCAGG + Intergenic
1083867302 11:65463233-65463255 ATAAAATTACAGAAATTGGCTGG + Intergenic
1083950888 11:65955449-65955471 ATATATATACAAAAATTAGCTGG + Intronic
1084478925 11:69405868-69405890 ATTTCTTTAAAGAAGATGGCCGG - Intergenic
1086457306 11:86972064-86972086 AAATCTTTACAGAAATTAGCTGG + Intergenic
1087296460 11:96381158-96381180 TTTTATTTCCATTAATTGGCAGG + Intronic
1087741952 11:101898059-101898081 ATTAAATTACAAAAATTAGCTGG + Intronic
1087951420 11:104224944-104224966 ATTTCTTTACTGAGATTGGAAGG + Intergenic
1088121821 11:106379041-106379063 ATTAATTTACATAAATCAGCAGG - Intergenic
1088268016 11:108006038-108006060 ATTTCTATACAAAAATTAGCCGG + Intergenic
1088576425 11:111276478-111276500 ATATATGTACAAAAATTAGCTGG + Intronic
1088722930 11:112610430-112610452 TTTTGTTTAAAGAAATTGACAGG - Intergenic
1091006193 11:131955954-131955976 AATTATTTACAGAACTTGTGAGG + Intronic
1091997403 12:5004584-5004606 ATTTATGGACAGAAAATGGAAGG + Intergenic
1092492520 12:8958544-8958566 ATTTTTTAACAGAAATTGACAGG - Intronic
1093080145 12:14801493-14801515 ATTTTTTTTCAGAGATTGGTAGG - Intronic
1093128208 12:15355975-15355997 TTTTAATTACAGAAAATGACAGG + Intronic
1093695380 12:22153912-22153934 ATTTCTTTACAGAAATCAGCTGG - Intronic
1093783544 12:23166164-23166186 ATTTATTTACACAAGATGTCTGG + Intergenic
1094050118 12:26210550-26210572 ATTTATTTATTGAAATAGCCAGG + Intronic
1094370377 12:29731184-29731206 ATTTATTTATATAAAAAGGCTGG + Intronic
1094643509 12:32299051-32299073 ATTCATTTACACAAATTGCTAGG - Intronic
1095091238 12:38108423-38108445 ATTTTTGTACAGAAATAGCCCGG + Intergenic
1096250766 12:50031070-50031092 GTTTATTTTTAAAAATTGGCCGG - Intronic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1097575975 12:61393083-61393105 ATTAGATTACAGAAATAGGCAGG + Intergenic
1097988113 12:65805685-65805707 ATAAATTTAAAAAAATTGGCTGG + Intergenic
1098476005 12:70904241-70904263 ATTTGTTTACAGACATTTGTGGG - Intronic
1098783220 12:74715085-74715107 ATATATATACAAAAATTAGCCGG - Intergenic
1100289847 12:93203084-93203106 ATTTATTAAAAGAAATCAGCAGG - Intergenic
1100506179 12:95222663-95222685 ATTTTTTTACAAAAACTGACAGG - Intronic
1101031474 12:100664810-100664832 ATATATATACAAAAATTAGCTGG - Intergenic
1101120946 12:101579554-101579576 ATTTATTTATAGAGATGGGGGGG - Intronic
1101796159 12:107976167-107976189 TTTTCCTTGCAGAAATTGGCAGG - Intergenic
1102327930 12:112004581-112004603 ATTTGTTTAAAAATATTGGCTGG - Intronic
1102748201 12:115268652-115268674 CTTTATTTACAGAATCAGGCAGG + Intergenic
1103117280 12:118347163-118347185 ATTTTTTTAAAAAAATTAGCTGG - Intronic
1103216117 12:119202637-119202659 TTCTATCTCCAGAAATTGGCTGG - Intronic
1103240539 12:119409673-119409695 CTTTATTTACAGAAACAGGCAGG + Intronic
1104003569 12:124875906-124875928 CTTTATTTACAAAAACAGGCTGG - Intronic
1104003575 12:124875946-124875968 CTTTATTTACAAAAACAGGCTGG - Intronic
1104406189 12:128518969-128518991 ATATATTTACAGAACTTAGAAGG + Intronic
1104674253 12:130702025-130702047 GATTATTGACTGAAATTGGCTGG - Intronic
1104831466 12:131754927-131754949 ATTTATCTAAAGACATTGGTTGG - Intronic
1105757112 13:23476743-23476765 TTTTTTTTGCAGAAATTGACAGG - Intergenic
1105985263 13:25560154-25560176 ATTTACATACAAAAATAGGCAGG - Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109556920 13:63988579-63988601 ATTTTTTTACACAAATTGAGAGG + Intergenic
1110114254 13:71792192-71792214 ATTTATTCAGAGAAATTTACTGG - Intronic
1110254492 13:73417622-73417644 AAGAATTTACAAAAATTGGCCGG + Intergenic
1111161683 13:84402868-84402890 ATATATTTACAGAAGGTTGCAGG + Intergenic
1111408208 13:87838071-87838093 ATTTTTTTACATAAATAGGGTGG - Intergenic
1111825165 13:93258521-93258543 ATTTATTTACAGAAACTTGGGGG - Intronic
1111952978 13:94724816-94724838 ATTTAAAAACAGAGATTGGCCGG - Intergenic
1112513359 13:100029932-100029954 ATTTTTTTAAAAAAATTAGCTGG + Intergenic
1112522640 13:100110990-100111012 ATTTAAATACAAAAATTAGCCGG - Intronic
1112704823 13:102055736-102055758 CTTTATTTGCAAAAATAGGCAGG - Intronic
1112831495 13:103458179-103458201 ATTTATTTAAAAACTTTGGCCGG + Intergenic
1112892299 13:104252975-104252997 ATTTATTTAAAGAAGTCGGGAGG - Intergenic
1112987985 13:105475857-105475879 ATCTATTTACAGAACTTAGCAGG + Intronic
1113394756 13:109936802-109936824 ATTTATTTTAAGGAATTGGCTGG - Intergenic
1115197432 14:30816641-30816663 ATTAAAATACAAAAATTGGCCGG - Intergenic
1115922434 14:38391112-38391134 ATTTATTTCTATAAATAGGCTGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116536535 14:46038619-46038641 ATGTATATACAAAAATTAGCTGG - Intergenic
1116680603 14:47964880-47964902 ATTTATTTTCAGAACTTGGAAGG + Intergenic
1116923956 14:50613878-50613900 ATGTATTTACATAAAGTGGGAGG + Intronic
1116999957 14:51362372-51362394 CTATATTTAAAAAAATTGGCCGG + Intergenic
1117409204 14:55435218-55435240 AATTATTTCCAGAAATTTGATGG + Intronic
1117819682 14:59634892-59634914 ACTTAATTACAGAAATGTGCAGG + Intronic
1118894363 14:69933252-69933274 ATTTATTTTCAGAAACAGGATGG + Intronic
1119012092 14:71004078-71004100 ATTTATTTACAAAAACAGGTAGG - Intronic
1119416024 14:74469891-74469913 ATTAATTTACAGAAATAAACAGG + Intergenic
1119456144 14:74757140-74757162 ACTTAGTTCAAGAAATTGGCTGG + Intergenic
1119695303 14:76708738-76708760 ATTAATTTAAAATAATTGGCTGG - Intergenic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120498449 14:85264081-85264103 ATTTATATATTGAATTTGGCAGG + Intergenic
1120531308 14:85634763-85634785 ATATATTTTCAGAAAGTAGCTGG - Exonic
1120804615 14:88733346-88733368 ATTTTCTTTCACAAATTGGCTGG + Intronic
1123031238 14:105452380-105452402 ATTAATTTAAAGAAACAGGCCGG + Intronic
1123180938 14:106469500-106469522 ATTTATTAATAGAATCTGGCTGG - Intergenic
1123540842 15:21288952-21288974 GTTTATTTAAAAATATTGGCCGG + Intergenic
1124896368 15:33780926-33780948 CTTTATTTACAAAAATAGGCAGG - Intronic
1125227979 15:37417291-37417313 ATTTATCCACATAAATTGGTTGG + Intergenic
1126050169 15:44677997-44678019 ATATATATACAAAAATTAGCTGG - Intronic
1127134304 15:55903860-55903882 ATATATATACACACATTGGCTGG + Intronic
1127460886 15:59198021-59198043 ATTTTTTTTCAAAAATTAGCTGG - Intronic
1127466991 15:59253797-59253819 ATTAATTTACAGAAAATGTAGGG + Intronic
1127467185 15:59255554-59255576 GCTTATTTACAAAAATTAGCTGG - Intronic
1127946263 15:63757422-63757444 AATTATTTACAAAAATTAGCCGG - Intronic
1128198399 15:65781514-65781536 ATTTATTTACTGAATTCTGCTGG - Intronic
1130019649 15:80217556-80217578 ATTTATTTAGAGACAGTGTCTGG + Intergenic
1130526542 15:84711942-84711964 ATTAATTTAAACAACTTGGCTGG + Intronic
1131170105 15:90172048-90172070 ATATATTTGCACATATTGGCTGG + Intronic
1131175864 15:90209401-90209423 ATATATATACAAAAATTAGCCGG + Intronic
1131745009 15:95437921-95437943 ACTTATCTACAGAAATTTACAGG - Intergenic
1131813628 15:96200137-96200159 ATTTAATTAAAGTAATTGACTGG + Intergenic
1202949155 15_KI270727v1_random:16094-16116 GTTTATTTAAAAATATTGGCCGG + Intergenic
1133928481 16:10212899-10212921 AAATATATACAGAAATTAGCTGG + Intergenic
1135358912 16:21794446-21794468 ATTTTATTACAGTAATGGGCAGG - Intergenic
1135457468 16:22610882-22610904 ATTTTATTACAGTAATGGGCAGG - Intergenic
1135633331 16:24053436-24053458 CTTTATTTACAAAAACAGGCAGG + Intronic
1136635009 16:31515189-31515211 ATAAAAATACAGAAATTGGCTGG + Intergenic
1136728074 16:32378649-32378671 TTTTATTTATAAAAATAGGCTGG + Intergenic
1137038442 16:35587710-35587732 ATATATATACAAAAATTAGCTGG - Intergenic
1138608095 16:58101614-58101636 ATATATATACAAAAATTAGCTGG - Intergenic
1138608228 16:58102586-58102608 TTTTTTTTACAAAAATTAGCCGG - Intergenic
1139014452 16:62673186-62673208 ATATTGTTACAGAATTTGGCTGG + Intergenic
1139996409 16:70985175-70985197 ATTTACTTACAGACACAGGCAGG + Exonic
1140921097 16:79539339-79539361 CTAAAATTACAGAAATTGGCCGG + Intergenic
1141351459 16:83301848-83301870 CTTAATTTAAAGAAATAGGCAGG + Intronic
1141358205 16:83369578-83369600 ATAAATTTAAAAAAATTGGCAGG - Intronic
1202998365 16_KI270728v1_random:139105-139127 TTTTATTTATAAAAATAGGCTGG - Intergenic
1203129958 16_KI270728v1_random:1675509-1675531 TTTTATTTATAAAAATAGGCTGG - Intergenic
1142657095 17:1401294-1401316 ATATATATACAAAAATTAGCTGG + Intergenic
1142750033 17:1982002-1982024 ATTTATGTATTGAAACTGGCCGG + Intronic
1142855333 17:2726155-2726177 ATATATATACAAAAATTAGCTGG - Intergenic
1143785417 17:9252006-9252028 ATATATTTAAAAAAATAGGCCGG + Intronic
1144845218 17:18214223-18214245 ATTTTTTTAAAGAAATTAGCAGG - Intergenic
1146377144 17:32302518-32302540 ATATATATACAAAAATTAGCTGG - Intronic
1146439159 17:32878231-32878253 ATTTATTTAAAAAAAATAGCTGG - Intergenic
1147955466 17:44131430-44131452 ATAAAATTACAAAAATTGGCTGG + Intergenic
1148005073 17:44421177-44421199 TTTTCTTTACAAAAATTAGCCGG + Intronic
1148036961 17:44671386-44671408 TTTTCTTTACAAAAATTAGCTGG + Intronic
1148196560 17:45717536-45717558 ATATATATACAAAAATTAGCTGG - Intergenic
1148374570 17:47131100-47131122 GTTTATTTGAAGAAATTGTCAGG - Intronic
1148474531 17:47918830-47918852 CTTTATTTACAAAAACAGGCAGG - Intronic
1148649057 17:49236653-49236675 ATATATATACAAAAATTAGCTGG - Intergenic
1149171772 17:53820734-53820756 ATTTTCTTACTGAAAATGGCAGG - Intergenic
1150378770 17:64704172-64704194 ATAAAATTACAAAAATTGGCTGG + Intergenic
1150856730 17:68760276-68760298 ATTTATTTTAAGGAATTGGCTGG + Intergenic
1151146865 17:72049350-72049372 ATTTATTTACTGCAACTGGGTGG - Intergenic
1151203172 17:72483902-72483924 GTTTATTTACAAAAGGTGGCAGG + Intergenic
1151853048 17:76702476-76702498 ATTTATTTAGAGAACCAGGCTGG - Intronic
1152034926 17:77866338-77866360 ATGTATATACAAAAATTAGCTGG + Intergenic
1152307896 17:79531812-79531834 ATTGATTTGCACAAATTGCCTGG - Intergenic
1153734260 18:8047987-8048009 ATTTATTTACTGAAAATGGACGG - Intronic
1153755908 18:8282761-8282783 ATTTATTTACAGAGTTTTGTGGG - Intronic
1153925256 18:9830160-9830182 ATTTTTTTAAAAAAATTAGCTGG - Intronic
1154950846 18:21208109-21208131 ATTTTCTTTCAGAAATTTGCAGG + Intergenic
1155035880 18:22024538-22024560 TTTAATTTAAATAAATTGGCCGG - Intergenic
1155268725 18:24118812-24118834 ATTTTTTTTAAAAAATTGGCTGG - Intronic
1155761220 18:29569660-29569682 ATTTATTTCCAGCAATTTGAAGG + Intergenic
1156185164 18:34654084-34654106 ATTTATTTATAGGACTTGGGTGG + Intronic
1156547405 18:37978490-37978512 ATTTAATCACAGAACATGGCTGG + Intergenic
1156714671 18:39993453-39993475 ATTTACTTACAAAAATTAACCGG - Intergenic
1156726051 18:40128808-40128830 ATTTATTTACAGAGGTAGTCAGG + Intergenic
1157095972 18:44685674-44685696 GTTCAATTACAGAAATTAGCTGG - Intronic
1157122366 18:44923528-44923550 ATTAATTTAAAGAACATGGCTGG - Intronic
1157203059 18:45675674-45675696 ATATATATATAGAAATTAGCTGG - Intronic
1157884231 18:51350935-51350957 ATTTATTTCCAGAACTCAGCTGG + Intergenic
1157993436 18:52525491-52525513 ATTCATTTACACAAAGTGGATGG + Intronic
1158353901 18:56594932-56594954 ATTTCTATATAGAAGTTGGCTGG + Intergenic
1158998333 18:62946755-62946777 ATAAATTTCCAGAATTTGGCTGG + Intronic
1159509585 18:69378979-69379001 ACTAATATACAGAAATTAGCTGG - Intergenic
1159514674 18:69442965-69442987 ATTTATTTACAAATAATGGAGGG + Intronic
1159904832 18:74080149-74080171 ATTTATTTTAAGAAATTGCTTGG - Intronic
1160472622 18:79151066-79151088 ATGTCTTTGCAGAAATTGACAGG + Intronic
1161202292 19:3022208-3022230 TTTTTTTTACAAAAATTAGCTGG - Intronic
1161410856 19:4116498-4116520 ATTTATTCTAAGGAATTGGCTGG - Intronic
1161614502 19:5262549-5262571 ATTTAATTACAGAAGTTTGGGGG - Intronic
1162309618 19:9898211-9898233 ATTTTTTTAAAAAAATTAGCTGG - Intronic
1162473040 19:10883719-10883741 AATTTTTTAAAAAAATTGGCTGG + Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164868206 19:31622645-31622667 ATTTCTTCACACAAATTGACAGG + Intergenic
1167107980 19:47441805-47441827 ATTTATTTTAAAAAATAGGCCGG + Intronic
1167150240 19:47704612-47704634 ATATATATACAAAAATTAGCTGG + Intergenic
1167287339 19:48605845-48605867 TTTTATTTTAAAAAATTGGCCGG - Intronic
1167367124 19:49060491-49060513 AATTATATAAAGAAATTAGCTGG - Intronic
1167394353 19:49218090-49218112 ATATATGTACAAAAATTAGCCGG - Intergenic
1167659687 19:50789389-50789411 ATATATATACAAAAATTAGCCGG + Intergenic
1168226288 19:54997612-54997634 AGTGAAATACAGAAATTGGCTGG - Intronic
925220877 2:2139475-2139497 ATATATATACAAAAATTAGCTGG + Intronic
926468437 2:13221240-13221262 ATTTAGTTACAGATATTTGGAGG + Intergenic
927061120 2:19421127-19421149 ATTTATTTATTGCACTTGGCAGG + Intergenic
928526419 2:32146260-32146282 ATTAAAGTACAGAAAATGGCCGG + Intronic
928556776 2:32434686-32434708 ATTTTTTTAAAAAAATTAGCTGG + Intronic
928598630 2:32881747-32881769 ATATATACACAAAAATTGGCCGG - Intergenic
928633035 2:33213843-33213865 ATTTATTTAAACAATTTGGATGG + Intronic
928877339 2:36055727-36055749 ATTTATTTAAAAAAATTGACAGG - Intergenic
928968013 2:36996576-36996598 ATATATATACAAAAATTAGCCGG - Intronic
929039533 2:37730079-37730101 ATTCATTTAAATAAATTGGTTGG - Intronic
929347570 2:40905118-40905140 GCTTTTTTGCAGAAATTGGCAGG - Intergenic
930260201 2:49137464-49137486 ATTTCTTTGAAGAAATTGACAGG + Intronic
931240746 2:60450197-60450219 ATTTATTTACAGAATTTATTAGG - Intergenic
931578098 2:63741704-63741726 ATTTATTTAAAGAAATCAGAGGG - Intronic
932958415 2:76383423-76383445 ATTTAAAGACATAAATTGGCTGG - Intergenic
932993833 2:76823551-76823573 ATTTTGATACAGAAATTGTCAGG - Intronic
932998290 2:76884306-76884328 AATTATTAATAGAAATGGGCAGG + Intronic
933434565 2:82230667-82230689 ATTTTTTGACAAAAATTGACAGG + Intergenic
934317899 2:91942440-91942462 TTTTATTTATAAAAATAGGCTGG - Intergenic
935148528 2:100413188-100413210 AGTTAATTACAGAAAATGCCAGG - Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935658644 2:105446745-105446767 CATTATTTACAGTAATTGACAGG - Intergenic
935808388 2:106771446-106771468 ATATATTATCAGAAACTGGCTGG - Intergenic
936619327 2:114078936-114078958 TTTTTTTTACAGAAATTGTAGGG + Intergenic
936818306 2:116487282-116487304 ATTTATTTATGGATAATGGCAGG - Intergenic
938427567 2:131203691-131203713 TTTTATTTAAAAATATTGGCTGG - Intronic
938468507 2:131537729-131537751 TTTTATTTAAAAATATTGGCCGG - Intergenic
939330690 2:140756305-140756327 GTTTATTTGCCAAAATTGGCAGG + Intronic
939341721 2:140904803-140904825 ATTTCTTTACAGTAATTCTCTGG - Intronic
939498651 2:142952918-142952940 ATTTATTTAAAAAAAATGGCAGG - Intronic
939771339 2:146323357-146323379 ATTTAATTACACACATTTGCTGG - Intergenic
939850561 2:147299185-147299207 TTTTATTTAAAGAACTTTGCAGG + Intergenic
942131758 2:172886889-172886911 ATTTAATTTGAAAAATTGGCCGG + Intronic
942488069 2:176460050-176460072 CTTGATTTAAATAAATTGGCTGG + Intergenic
942539172 2:176997412-176997434 ATTTATTTAAAGAACTTTTCTGG - Intergenic
943693335 2:190893082-190893104 AATTATTTACAGCAAATGGTTGG - Intronic
944568934 2:201023050-201023072 ATTAATATAAAGAAATAGGCTGG + Intronic
945119153 2:206441204-206441226 ATTTATTTACAGAACTTTAATGG - Intergenic
945817056 2:214618341-214618363 AATTATTTACTGAATTTGCCAGG - Intergenic
946022611 2:216651477-216651499 CTTTGTTTACAGAATTTAGCGGG - Intronic
946674931 2:222149468-222149490 ATTTTTTACCAGAATTTGGCTGG - Intergenic
947169849 2:227299986-227300008 AGTTATTTAGAAACATTGGCAGG - Intronic
947200715 2:227612424-227612446 ATATATATACAAAAATTAGCTGG - Intronic
947356402 2:229300444-229300466 ATTTAATAACAGAGATTGTCTGG - Intergenic
947359018 2:229328243-229328265 TTTTGTTTTTAGAAATTGGCAGG + Intergenic
948213613 2:236212784-236212806 ATTTTTTTAAAAAAATTAGCAGG - Intronic
1168984186 20:2033756-2033778 ATTTATTTACAGAGGTGGGAGGG + Intergenic
1169377232 20:5075945-5075967 ATATATATACAAAAATTAGCTGG + Intronic
1171032291 20:21688134-21688156 ATTTATTTACAGAACGTGTTAGG + Intergenic
1171792594 20:29541721-29541743 ATTTTTTTAAAAAAATTAGCTGG + Intergenic
1172640591 20:36438063-36438085 AATTATTTAAAAAAATTAGCTGG - Intronic
1173206228 20:40996229-40996251 ACTTATTTAAAAAAATTGGCTGG - Intergenic
1174087611 20:48020164-48020186 ATTTATTGTTAGAAATTGACAGG + Intergenic
1174128436 20:48325687-48325709 ACTTATTGTTAGAAATTGGCAGG - Intergenic
1174589178 20:51631618-51631640 ATAAATTTACAGAGATCGGCCGG + Intronic
1177404791 21:20651325-20651347 TTTTATTTACAAAATTTGGTTGG + Intergenic
1178367796 21:32001844-32001866 AGTTACTGACAGAAATTGACTGG + Exonic
1179145859 21:38766768-38766790 ATATATATACAAAAATTAGCTGG + Intergenic
1179332884 21:40422478-40422500 ATATATATACAAAAATTAGCCGG + Intronic
1179841259 21:44075744-44075766 ATTTATTTTAAAAAATTTGCTGG - Intronic
1179841261 21:44075751-44075773 ATTTTTTAAAATAAATTGGCTGG + Intronic
1181136682 22:20771978-20772000 ATTTATTCACAGAAATGGTCTGG - Intronic
1181288911 22:21775636-21775658 ATTAATTTAAAAAAATTAGCTGG - Intronic
1181979201 22:26753956-26753978 GTAAATTGACAGAAATTGGCTGG + Intergenic
1183288518 22:36983041-36983063 ATTTATTTGAAGAAGTTGCCTGG + Intergenic
1184065539 22:42117513-42117535 TTACATTTACAGAAATTTGCAGG + Intergenic
1184817714 22:46884710-46884732 CTTTATTTACAAAAATGGGTGGG + Intronic
949544005 3:5056633-5056655 ATTTCTCTTAAGAAATTGGCTGG + Intergenic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951120324 3:18919145-18919167 ATTTATTTACAGAAGTCTGTGGG - Intergenic
951308688 3:21097937-21097959 ATTTATTCAAAGAAAATGTCTGG + Intergenic
951354689 3:21650404-21650426 CTTTCTTTACAGTAATTGGCAGG - Intronic
951500685 3:23383693-23383715 ATATATTTTCAGATATTGCCAGG - Intronic
951733400 3:25836060-25836082 TTTTATTTAGAGAAATTAGGAGG + Intergenic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952760321 3:36907758-36907780 ATTTATTTAAAAATATTGGCCGG - Intronic
953278969 3:41533560-41533582 TTTTATTTACAGAATTAGGTGGG - Intronic
954239603 3:49283308-49283330 ATATATTTAAAAAAATAGGCTGG - Intronic
955005517 3:54965191-54965213 CTTTATTTACAAAAAGAGGCTGG + Intronic
955078552 3:55636751-55636773 CTTTATTTACAAAAACAGGCAGG + Intronic
955124090 3:56092474-56092496 ATGTGTTTTCAGAAATTTGCTGG - Intronic
955587599 3:60498093-60498115 CTTTAGTTACAGAAACAGGCAGG + Intronic
955702780 3:61698443-61698465 CTTTATTTACATAAACAGGCAGG + Intronic
956547486 3:70420349-70420371 ATTTGTTTTCAGAAATGTGCTGG + Intergenic
956687443 3:71843237-71843259 ATTTATTTACGAAAACTGGCTGG - Intergenic
957424773 3:80023469-80023491 ATTTATTTACTGAAATTTTTTGG + Intergenic
957434787 3:80160991-80161013 ATTAAATTGCAAAAATTGGCTGG - Intergenic
957467581 3:80614528-80614550 ATAAATTTACAAAAATTAGCTGG + Intergenic
957518469 3:81287500-81287522 TTTAATTTGCAAAAATTGGCTGG - Intergenic
957827934 3:85474200-85474222 ATTTATTTTAAGGGATTGGCTGG + Intronic
957949275 3:87104333-87104355 ATTTAATTACAGAAATGTGGAGG + Intergenic
959361488 3:105399233-105399255 AAATATTTACTGAAATTTGCTGG - Intronic
959920792 3:111866178-111866200 ATTAAAGTACAGAAATTAGCTGG - Intronic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
960411658 3:117334134-117334156 ATCCATTTATAGAAATTGGTAGG - Intergenic
961764088 3:129194636-129194658 ATATATATACAAAAATTAGCTGG + Intergenic
962103150 3:132363773-132363795 ATTAAAATACAAAAATTGGCCGG + Intronic
962517859 3:136170189-136170211 ATATATATACAAAAATTAGCTGG + Intronic
963715839 3:148802833-148802855 ATAAATTTAAAAAAATTGGCGGG + Intronic
963865723 3:150358789-150358811 ATATATATACAAAAATTAGCTGG - Intergenic
964002743 3:151795893-151795915 ATTTCTTTAAAAAAATTAGCTGG + Intergenic
964418506 3:156475432-156475454 ATTTATTTACAGAACTTGCTAGG + Intronic
964508025 3:157420995-157421017 ATCCATTTACAGAAAAAGGCTGG - Intronic
966230577 3:177647340-177647362 ATTTATTGACAGAGAATTGCAGG - Intergenic
966474057 3:180323732-180323754 ATACATTCACAGAAAATGGCCGG - Intergenic
967125111 3:186416230-186416252 CTTTATTTACAAAAAGTGGTGGG - Intergenic
967599155 3:191364020-191364042 ATTCTTTTTCAAAAATTGGCCGG - Intronic
968458553 4:711766-711788 ATTTTTCTACAGAATTAGGCAGG + Intronic
969098826 4:4753814-4753836 CTTTATTTACAAAAATAAGCAGG + Intergenic
969142021 4:5084105-5084127 ATTTAAATACAGAGATTGGAGGG - Intronic
970258218 4:14192337-14192359 ATATATACACAAAAATTGGCCGG - Intergenic
970438369 4:16057566-16057588 ATTAGTTTACAGAAAATGGCTGG - Intronic
970885951 4:20987701-20987723 AAATATTTATAGATATTGGCCGG + Intronic
972478452 4:39475217-39475239 ATATATATACAAAAATTAGCCGG + Intronic
972501528 4:39682525-39682547 ATTTTTTTAGAAAAATTAGCTGG - Intergenic
972544096 4:40063954-40063976 ATTTATTTAGAGAGATTGGTGGG + Intronic
972605336 4:40608452-40608474 ATTTATTTTCCAAAATGGGCAGG + Intronic
973115376 4:46451184-46451206 AATTGTGTCCAGAAATTGGCAGG + Intronic
973988692 4:56381414-56381436 ATATATATACAAAAATTAGCCGG + Intronic
974358902 4:60850036-60850058 ATTTTTTTCTAGAAATTGGATGG - Intergenic
974471752 4:62328086-62328108 ATTTATTTACAGAAGTGGTCTGG + Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976668386 4:87624950-87624972 ATTTATGGACAGAAATAGGAAGG - Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977679349 4:99781851-99781873 ATGTATTTATAGAAAATGGCTGG - Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977744197 4:100525697-100525719 ATTTATTTCGAGAAGTTGGATGG - Intronic
977950379 4:102963727-102963749 TTTTATTTATAAAAATAGGCTGG - Intronic
978249605 4:106614412-106614434 CTTTATTTACAGAAATTTTAGGG - Intergenic
978326042 4:107557102-107557124 CTTTATTTAAAGAATTTGGATGG + Intergenic
978690402 4:111502595-111502617 ATTTTTTTGTAGAAATTGGTAGG - Intergenic
979189596 4:117839998-117840020 ATATATATACAAAAATTAGCTGG - Intergenic
979661601 4:123261939-123261961 ATTTTTTTAAAAAAATTAGCTGG - Intronic
979969757 4:127119826-127119848 ATATATATTCAAAAATTGGCTGG - Intergenic
980006073 4:127544045-127544067 ATTTATTTTAAGAAATTTCCTGG + Intergenic
980312947 4:131158200-131158222 ATGTATCTACAGAAATTAGGTGG + Intergenic
982928542 4:161370876-161370898 ATTTTTTTAAAAAAATTAGCGGG + Intergenic
983039574 4:162909496-162909518 ATTTATTTACCTTAAATGGCCGG - Intergenic
983136294 4:164085952-164085974 ATTTTTGTACAGAAATGGGGGGG + Intronic
983179296 4:164629388-164629410 ATTTATTTACACAAATTTATAGG - Intergenic
983261822 4:165465343-165465365 ATTTATTTACAGAAATTGGCTGG - Intronic
983323117 4:166219622-166219644 ATTTATTTAAAGAATTTACCTGG - Intergenic
983640952 4:169943444-169943466 ATCTTTTTAAAGAAATTGGCTGG - Intergenic
984310985 4:178057661-178057683 ATTTGTTTAGAGAAATTTTCTGG + Intergenic
984773568 4:183460368-183460390 ATATATTTTAAGAAATTAGCTGG + Intergenic
985788266 5:1911247-1911269 ATTCATTTAAAGCAATTGCCAGG + Intergenic
987161118 5:15144091-15144113 AGTTATCTATAGAAATTGTCTGG - Intergenic
987907488 5:24095397-24095419 ATCTATTTAAAGAAATAGGCCGG - Intronic
988301080 5:29427990-29428012 TTTCAGTTCCAGAAATTGGCTGG + Intergenic
988390352 5:30619819-30619841 ATTTCTTAGCAGAAATTTGCAGG - Intergenic
988777230 5:34488430-34488452 ATTTATCATCAGAAATTGTCGGG + Intergenic
990095926 5:52112738-52112760 ATTTGTTTCCAGAAATTTGGTGG + Intergenic
990478145 5:56181889-56181911 AGTAATATACAGAAATAGGCCGG - Intronic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991141305 5:63247062-63247084 CTTTATTTACAGTAACAGGCAGG - Intergenic
991181813 5:63760740-63760762 ATTTATTTTCAGGAATTAGAAGG + Intergenic
992923612 5:81556061-81556083 CTTTATTTACAAAAATTGGCAGG + Intronic
993275216 5:85849010-85849032 ATTTATTTATACACATTTGCAGG + Intergenic
993432677 5:87851078-87851100 ATTTATTTATGTAAATTGCCTGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994641574 5:102416716-102416738 TTTTATTTACATAAATTTGTGGG - Intronic
994894540 5:105685697-105685719 ATTTATTTGAAGCAATGGGCTGG - Intergenic
994934496 5:106236855-106236877 CTTAATTTAAAGAAATAGGCAGG - Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995430450 5:112069127-112069149 ATTTATTTTCAAAAAATGTCTGG + Intergenic
996042426 5:118830607-118830629 ACTTCTTTACAGAATTTTGCTGG + Intergenic
996104091 5:119478361-119478383 ATTTATTTTCAGAAACTGTCAGG - Intronic
996311704 5:122113335-122113357 GTTTATTTAAAGGAAGTGGCGGG + Intergenic
996384094 5:122892408-122892430 ATTTATTTAAAGGAAATGACAGG - Intronic
997032122 5:130142678-130142700 ATTTAATAACAGAAACTGTCTGG - Intronic
997246775 5:132356456-132356478 ATTAATTTAAAAAAATTAGCAGG + Intergenic
997539144 5:134647317-134647339 ATTTAATTAAAAACATTGGCTGG + Intronic
998074841 5:139227296-139227318 ATAAATATACAGAAATTAGCTGG + Intronic
998628531 5:143873204-143873226 ATTTATTTTGAAGAATTGGCTGG + Intergenic
998953422 5:147414394-147414416 AGTGATTTACAGAAATAGGTGGG + Intronic
999332398 5:150684692-150684714 ATGTTTTTGTAGAAATTGGCAGG + Intergenic
999780496 5:154845945-154845967 ATATATATACAAAAATTAGCTGG - Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000465788 5:161574396-161574418 ATTATTTTAGAGAGATTGGCAGG + Intronic
1000494196 5:161957874-161957896 ATTTATTTTCAGAAATTTACAGG + Intergenic
1000845097 5:166269814-166269836 ATCTAAATACAGAAATTAGCTGG - Intergenic
1000903957 5:166940504-166940526 CTTTATTTACAAAAACAGGCGGG - Intergenic
1000913748 5:167054204-167054226 AGATATTTACAGGAATTAGCAGG - Intergenic
1001464858 5:171954759-171954781 TTTTTTCTACAGAATTTGGCAGG + Intronic
1001617335 5:173053647-173053669 AATTATTTTAAGAATTTGGCCGG + Intergenic
1001720060 5:173849646-173849668 ATTTATTTAGAGATGGTGGCTGG + Intergenic
1003056478 6:2825290-2825312 ATATATATACAAAAATTAGCTGG + Intergenic
1003233374 6:4274658-4274680 ATTTATTTAAAGAAATAAGCAGG - Intergenic
1003832862 6:10033790-10033812 ATGTATTTGCAGTAATTGCCAGG - Intronic
1004385415 6:15168630-15168652 ATATATATACAAAAATTAGCTGG + Intergenic
1004539079 6:16532105-16532127 CTTAATTTACAGAAACAGGCTGG + Intronic
1004701809 6:18086698-18086720 TTTTATTAAAAAAAATTGGCTGG + Intergenic
1005665801 6:28053106-28053128 ATTTATGTAAAGAAATTTCCTGG + Intergenic
1006708887 6:36047895-36047917 ATATATTTAAAAAAATTAGCTGG - Intronic
1006886983 6:37390114-37390136 AATTATATACAGGAATAGGCAGG - Intronic
1007079781 6:39091505-39091527 ATTTAATTAGAGAAGTTGGGTGG + Intergenic
1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG + Intergenic
1008324329 6:50159360-50159382 ATTTATATATAGAAAATGGGGGG + Intergenic
1008746635 6:54677973-54677995 ATTTGTTTACAGGAATTAGAGGG + Intergenic
1008996188 6:57662211-57662233 ATTTCTTTACAGAAATATTCTGG - Intergenic
1009184716 6:60560994-60561016 ATTTCTTTACAGAAATATTCTGG - Intergenic
1009611477 6:65947159-65947181 ATTTATTTAGAGAAAGGGTCTGG + Intergenic
1010321817 6:74519526-74519548 ATTTATTTACATAAATTGTTGGG - Intergenic
1010405967 6:75506055-75506077 ATTAATGTGCAAAAATTGGCTGG + Intergenic
1010787845 6:80025726-80025748 CTTTGTTTACAAAAATAGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011888879 6:92131840-92131862 ATTTCTTCATAGCAATTGGCAGG - Intergenic
1012160625 6:95880740-95880762 ATTTATTTAGAGGAATTTGAAGG + Intergenic
1012681295 6:102184704-102184726 ATTTATTTATAGACATTGAATGG - Intergenic
1012810900 6:103956796-103956818 ATTTTTTGACAAATATTGGCTGG + Intergenic
1012887432 6:104861238-104861260 ATGTATATACAAAAATTAGCCGG + Intergenic
1014334196 6:120111523-120111545 ATTTATTTACAAAAATAGACGGG + Intergenic
1014439545 6:121458454-121458476 ATTTATTTAAAGTTCTTGGCTGG - Intergenic
1014964274 6:127727706-127727728 ATTTATATACAGTAATTTGAAGG - Intronic
1015153724 6:130066752-130066774 ATTTAATAATAGAAATTTGCAGG - Intronic
1015511940 6:134046647-134046669 ATATATATACAAAAATTAGCCGG + Intronic
1015831830 6:137378094-137378116 AGTTATTCACAGAAAATGGAAGG + Intergenic
1016469230 6:144357749-144357771 ATTTATTTGCTGATATTGGTTGG + Intronic
1016673508 6:146736135-146736157 TTTTCTTTACAAAAATTGGATGG + Intronic
1016679864 6:146816444-146816466 CTGTCTCTACAGAAATTGGCCGG - Intergenic
1018146814 6:160899274-160899296 AATTTTTTACAAAAATTAGCTGG - Intergenic
1019682391 7:2358455-2358477 ATTTATTCTCAAAAGTTGGCTGG - Intronic
1020610986 7:10397785-10397807 TTATATTTACAGAAATGGGCTGG - Intergenic
1021513453 7:21458478-21458500 ATTTATAGACATAAACTGGCCGG - Intronic
1021588406 7:22235042-22235064 ATTTTTTTAAAGAAATGGGTTGG - Intronic
1022020125 7:26391317-26391339 ATTTCTTTAAAAAAGTTGGCTGG - Intergenic
1022086311 7:27071160-27071182 ATATATTTACATATATTGGCTGG + Intergenic
1022339289 7:29453405-29453427 AGCTGTTTACAGAAATTGTCTGG + Intronic
1023461273 7:40399885-40399907 ATTTTTATACAAAAATTAGCTGG + Intronic
1023541138 7:41267397-41267419 ACTTATTTACAAACATGGGCCGG + Intergenic
1023971359 7:44993595-44993617 ATTCACTTAAAAAAATTGGCTGG + Intergenic
1025601761 7:63006968-63006990 ATTTCTCTTCAGTAATTGGCAGG - Intergenic
1025651607 7:63474819-63474841 ATTTATTTTAAGGAATTGACTGG - Intergenic
1026793612 7:73351323-73351345 AATTAATTACAAAAATTGCCAGG - Intronic
1027135757 7:75622899-75622921 ATTTTTTAAAGGAAATTGGCTGG + Intronic
1027173742 7:75890295-75890317 CTCTATTTACAAAAATTAGCCGG + Intergenic
1027593163 7:80139690-80139712 TTTTGTTTACATAATTTGGCTGG - Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027760215 7:82268453-82268475 ATTTAATTACAAAAATTTACTGG + Intronic
1028507161 7:91583251-91583273 ACTTACTTACAGAAATTGTCGGG + Intergenic
1028774601 7:94663322-94663344 CTTTATTTACAGAAATAAGCGGG + Exonic
1028796883 7:94912707-94912729 AATTATTTACAGATGTTAGCAGG + Intronic
1029375145 7:100172624-100172646 ATATATATACAAAAATTAGCCGG - Intronic
1029879782 7:103795983-103796005 TATTATTTACACAAATTGACTGG - Intronic
1030562152 7:111102069-111102091 TTTTTTTTAAAGAAATTGACAGG - Intronic
1030773488 7:113504277-113504299 ATCTATTTATATAAATTGACAGG - Intergenic
1030813209 7:114002195-114002217 TTTTATTTTCAGTAATTGCCTGG - Intronic
1030926449 7:115461300-115461322 ATCTATTTGCAGTATTTGGCAGG - Intergenic
1031059879 7:117039279-117039301 ATATATTTAAAAATATTGGCTGG + Intronic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031725850 7:125237356-125237378 ATATATTTAAAAAAATTAGCTGG + Intergenic
1031949251 7:127874778-127874800 ATTTAATTACAATAATTTGCAGG - Intronic
1031954970 7:127933801-127933823 ATTTATTTCCAGTAATGGGTAGG - Intronic
1032249162 7:130238954-130238976 ATTTATGTACAAAAATGGTCCGG - Intergenic
1032443064 7:131957115-131957137 ATTTCTTTACAGAAACTTCCCGG + Intergenic
1032732063 7:134653443-134653465 ACTTACTTACAGAAATAGACAGG - Intronic
1034135210 7:148761730-148761752 CTTTATTTACAGAAAAAGGCAGG + Intronic
1034670627 7:152854939-152854961 TTTTATTTACAAAAATAGGCTGG - Exonic
1035150346 7:156865553-156865575 ACTTTCTTACAGAAATTGACAGG + Intronic
1035831870 8:2703792-2703814 ATTTATTTTTAGAGATGGGCTGG + Intergenic
1036395351 8:8365816-8365838 ATATATATACAAAAATTAGCTGG + Intronic
1036584918 8:10114695-10114717 ATTGAATTAAAGAAATTTGCAGG + Intronic
1037919461 8:22794707-22794729 TTTTATTTACAGAAGTTTGAAGG + Intronic
1038450536 8:27636448-27636470 ATTTATTTAAAAAAAGAGGCAGG + Intronic
1038600309 8:28934627-28934649 AATAATATACAGAAATTGGCCGG + Intronic
1039233350 8:35473850-35473872 ATTTATTAACAGAAATTTGTTGG + Intronic
1039263864 8:35803568-35803590 ATTAAAATACAAAAATTGGCTGG + Intergenic
1039298002 8:36178728-36178750 ATATAATTACAGAAATTGGTTGG - Intergenic
1040051145 8:43015589-43015611 ATATATTTAAAGAAATTCTCTGG + Intronic
1040708926 8:50163644-50163666 ATTAAAATACACAAATTGGCCGG - Intronic
1040955833 8:52979026-52979048 ATTTTTATACAAAAATTAGCTGG - Intergenic
1041071227 8:54127747-54127769 ATATATATACAAAAATTAGCTGG + Intergenic
1042050941 8:64706060-64706082 ATTTATTTAAAGTACTTTGCTGG + Intronic
1042395167 8:68283632-68283654 ATTAAAAGACAGAAATTGGCAGG - Intergenic
1042744577 8:72093920-72093942 AGATATTTACAGGAATTTGCAGG + Intronic
1043292031 8:78613894-78613916 ATTTATTTACATAAAGTGCCAGG - Intergenic
1043479117 8:80634742-80634764 AATCATTTACAGAACTTGCCTGG + Exonic
1043770193 8:84188521-84188543 ATTTCTCTTCAGTAATTGGCAGG + Intronic
1043977018 8:86594868-86594890 ATATATATACAAAAATTAGCTGG - Intronic
1044318408 8:90775505-90775527 ATTAATGGACATAAATTGGCAGG - Intronic
1045665981 8:104485125-104485147 ATACATATAAAGAAATTGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046778711 8:118192205-118192227 ATATTTTTACAGAATTTGGGCGG + Intronic
1046858530 8:119064364-119064386 ATTTATATATAGAAATTAACTGG - Intronic
1047465818 8:125113041-125113063 ATATATTAACAGAAAATGGGGGG + Intronic
1047469135 8:125150542-125150564 ATTAAAATACAGAAATTAGCTGG - Intronic
1047595608 8:126374880-126374902 GTTTATTTACAAAAGATGGCTGG + Intergenic
1047729198 8:127712666-127712688 ATTTATTTGCAGCCACTGGCAGG + Intergenic
1048009897 8:130447024-130447046 ATATATTCACAGATACTGGCTGG + Intergenic
1048089970 8:131229186-131229208 AGTTATTTCCATAAACTGGCTGG - Intergenic
1048637258 8:136310688-136310710 ATTTTTTTACAGAAAAAGCCAGG + Intergenic
1048640692 8:136356747-136356769 ATTTATTGACAGAAAATTGTTGG + Intergenic
1050207371 9:3211400-3211422 AATGATTGACAGAAATTTGCTGG - Intergenic
1050596891 9:7213019-7213041 AATTTCTTAGAGAAATTGGCAGG + Intergenic
1050730667 9:8705379-8705401 ATTTAGGTACAGAAATTAGCTGG - Intronic
1051092819 9:13430184-13430206 ATTTATTTATAGGAATTAGATGG - Intergenic
1051217142 9:14810307-14810329 ATATATTTACAGAAATAGCTGGG + Intronic
1051264177 9:15295322-15295344 CTTTATTTACAAAAATAGGCAGG + Intronic
1051376429 9:16407248-16407270 CTTGATTTACAGAAATTTGCTGG - Intergenic
1052751114 9:32492004-32492026 ATTTCTTGACAGACATTGCCTGG - Intronic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1056568219 9:87793572-87793594 CTCTATTTACAGCAATTGGGTGG + Intergenic
1056599358 9:88034521-88034543 ATATATATACAAAAATTAGCCGG - Intergenic
1056879804 9:90380307-90380329 ATTTATCTACAGAATGTGGCAGG + Intergenic
1057093469 9:92282461-92282483 AATTTTTTACAAAAATTAGCTGG - Intronic
1057130631 9:92651875-92651897 ATATATGTACAAAAATTAGCTGG - Intronic
1057154427 9:92828727-92828749 ATTTTTTTAAAGAATTAGGCAGG - Intergenic
1057377244 9:94536164-94536186 ATTTATTTAGAGAAATCTTCAGG - Intergenic
1058340586 9:103891315-103891337 ATTTATTTAAAAAATTAGGCCGG + Intergenic
1058704706 9:107628679-107628701 ATTTATTTGAAAAATTTGGCTGG - Intergenic
1059197682 9:112385920-112385942 ATTAAATTAAAAAAATTGGCCGG - Intronic
1059222788 9:112641155-112641177 AATTAGTTACAGATATTTGCCGG - Intronic
1059388109 9:113980957-113980979 ATCTATTTGCTGATATTGGCAGG - Intronic
1059713214 9:116888682-116888704 TTTTAATTACAAAAATTAGCTGG - Intronic
1059846375 9:118281753-118281775 ATTGATTTACAGAGATTGAAAGG - Intergenic
1060261675 9:122080530-122080552 ATATATATACAAAAATTAGCTGG + Intronic
1060442092 9:123650508-123650530 ACTTATATACAGAAATTGACTGG - Intronic
1060512708 9:124245554-124245576 ATATATGTACAAAAATTAGCTGG - Intergenic
1060633898 9:125184818-125184840 ATATATATACAAAAATTAGCTGG + Intronic
1060988388 9:127834232-127834254 ATATATATACAAAAATTAGCTGG - Intronic
1061586409 9:131571996-131572018 ACATCTTTACAAAAATTGGCTGG + Intergenic
1186008386 X:5100929-5100951 TTTTATTTACATAAATTAGAGGG - Intergenic
1186023308 X:5281319-5281341 ATATATATACAAAAATTAGCTGG + Intergenic
1186085711 X:5988446-5988468 AATTATTCAAAGACATTGGCGGG + Intronic
1187138727 X:16573074-16573096 CTTTATTTACAAAAATAGGCAGG + Intergenic
1187250595 X:17594570-17594592 ATTTGTTGACAGAGATTGCCTGG - Intronic
1187368037 X:18680588-18680610 ATTTATATATATAAATTAGCTGG - Intronic
1188294139 X:28425632-28425654 ATTTATTTAAATAAAATGGAAGG - Intergenic
1188411858 X:29882650-29882672 CTTTATTTACAAAAACAGGCAGG + Intronic
1188742247 X:33800209-33800231 ATTTAGTTACAAAAAGTGGCCGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189632554 X:42970206-42970228 ATTGGTTTACAGAAATAAGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191977591 X:66890797-66890819 ATTTTTTTAAAAAAATTAGCCGG - Intergenic
1192015880 X:67330338-67330360 ATTTTTTTTCATATATTGGCAGG - Intergenic
1192796980 X:74432064-74432086 AAATATTTACAGCACTTGGCAGG + Intronic
1193133068 X:77938677-77938699 AATTATTTACAGAAATAAACAGG - Intronic
1193599290 X:83489515-83489537 AATTAATTAAAGAACTTGGCAGG + Intergenic
1194819572 X:98489174-98489196 CTTTATTCACAGAAATAGGGAGG + Intergenic
1194992976 X:100564574-100564596 ACTCATTTGCAGAAATTGACAGG + Intergenic
1196271850 X:113721419-113721441 ATTTATTTAAAGGAATTGGTTGG - Intergenic
1196516015 X:116612659-116612681 ATTTATTTACAGATAGTTGATGG - Intergenic
1196617541 X:117784947-117784969 AAGTATTTAAAGAAATTAGCTGG - Intergenic
1196822937 X:119717677-119717699 TTTTCTTTCCAGAAATTGACAGG + Intergenic
1197086683 X:122485035-122485057 AATTAAGTACAGAAATAGGCCGG + Intergenic
1197168795 X:123408356-123408378 ATCTATTTACAGAGAGTGACAGG - Intronic
1197651177 X:129066286-129066308 ATATATATACAAAAATTAGCTGG + Intergenic
1197721139 X:129745457-129745479 ATTTCTACACAGAAAGTGGCTGG - Intronic
1197857870 X:130936351-130936373 ATTTTTTCATAGAAATTGTCAGG + Intergenic
1198050469 X:132947366-132947388 ATTTTTTTTCAGAAATTGATAGG - Intronic
1199337359 X:146634562-146634584 ATTTATTTGCAGAAATTGATAGG + Intergenic
1199525961 X:148792289-148792311 ATTTATATACAAAAATTAGCCGG + Intronic
1200873721 Y:8129179-8129201 ATTTATTTTCAGAAAGCTGCAGG + Intergenic
1200969864 Y:9140228-9140250 ATTTATTTTCATCAACTGGCAGG - Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201185460 Y:11397472-11397494 TTTTATTTAGAAAAATAGGCTGG - Intergenic
1201769150 Y:17600982-17601004 ATTTTTGTACAGAAATAGCCTGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201832404 Y:18305003-18305025 ATTTTTGTACAGAAATAGCCTGG + Intergenic
1201927883 Y:19309775-19309797 ATTTGCTTACAGAAACTGTCAGG - Intergenic
1202137951 Y:21686771-21686793 ATTTGTCTACAGAAGATGGCAGG - Intergenic
1202141134 Y:21724022-21724044 ATTTATTTTCATCAACTGGCAGG + Intergenic
1202145731 Y:21779777-21779799 ATTTATTTTCATCAACTGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic