ID: 983265989

View in Genome Browser
Species Human (GRCh38)
Location 4:165508549-165508571
Sequence AGAAATGCAAAGATGCCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983265983_983265989 7 Left 983265983 4:165508519-165508541 CCACCGCCACACTCCTGCAGAGT No data
Right 983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG No data
983265981_983265989 24 Left 983265981 4:165508502-165508524 CCTTGGACATGTCCGCTCCACCG No data
Right 983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG No data
983265982_983265989 12 Left 983265982 4:165508514-165508536 CCGCTCCACCGCCACACTCCTGC No data
Right 983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG No data
983265984_983265989 4 Left 983265984 4:165508522-165508544 CCGCCACACTCCTGCAGAGTGAA No data
Right 983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG No data
983265985_983265989 1 Left 983265985 4:165508525-165508547 CCACACTCCTGCAGAGTGAATCC No data
Right 983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG No data
983265986_983265989 -6 Left 983265986 4:165508532-165508554 CCTGCAGAGTGAATCCTAGAAAT No data
Right 983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983265989 Original CRISPR AGAAATGCAAAGATGCCGCT GGG Intergenic
No off target data available for this crispr