ID: 983266028

View in Genome Browser
Species Human (GRCh38)
Location 4:165509117-165509139
Sequence AAGTCCTGGGTATAGCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983266028_983266040 23 Left 983266028 4:165509117-165509139 CCATGCAGCTATACCCAGGACTT No data
Right 983266040 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
983266028_983266036 20 Left 983266028 4:165509117-165509139 CCATGCAGCTATACCCAGGACTT No data
Right 983266036 4:165509160-165509182 CAACCACATCGACTGGGGGCTGG No data
983266028_983266033 14 Left 983266028 4:165509117-165509139 CCATGCAGCTATACCCAGGACTT No data
Right 983266033 4:165509154-165509176 CGCTAGCAACCACATCGACTGGG No data
983266028_983266035 16 Left 983266028 4:165509117-165509139 CCATGCAGCTATACCCAGGACTT No data
Right 983266035 4:165509156-165509178 CTAGCAACCACATCGACTGGGGG No data
983266028_983266032 13 Left 983266028 4:165509117-165509139 CCATGCAGCTATACCCAGGACTT No data
Right 983266032 4:165509153-165509175 TCGCTAGCAACCACATCGACTGG No data
983266028_983266038 22 Left 983266028 4:165509117-165509139 CCATGCAGCTATACCCAGGACTT No data
Right 983266038 4:165509162-165509184 ACCACATCGACTGGGGGCTGGGG No data
983266028_983266034 15 Left 983266028 4:165509117-165509139 CCATGCAGCTATACCCAGGACTT No data
Right 983266034 4:165509155-165509177 GCTAGCAACCACATCGACTGGGG No data
983266028_983266037 21 Left 983266028 4:165509117-165509139 CCATGCAGCTATACCCAGGACTT No data
Right 983266037 4:165509161-165509183 AACCACATCGACTGGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983266028 Original CRISPR AAGTCCTGGGTATAGCTGCA TGG (reversed) Intergenic
No off target data available for this crispr