ID: 983266030

View in Genome Browser
Species Human (GRCh38)
Location 4:165509131-165509153
Sequence AATAAGGTGCTAACAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983266030_983266041 26 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266041 4:165509180-165509202 TGGGGGATACCAGAACTCTGAGG No data
983266030_983266040 9 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266040 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
983266030_983266036 6 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266036 4:165509160-165509182 CAACCACATCGACTGGGGGCTGG No data
983266030_983266035 2 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266035 4:165509156-165509178 CTAGCAACCACATCGACTGGGGG No data
983266030_983266034 1 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266034 4:165509155-165509177 GCTAGCAACCACATCGACTGGGG No data
983266030_983266038 8 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266038 4:165509162-165509184 ACCACATCGACTGGGGGCTGGGG No data
983266030_983266043 28 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266043 4:165509182-165509204 GGGGATACCAGAACTCTGAGGGG No data
983266030_983266033 0 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266033 4:165509154-165509176 CGCTAGCAACCACATCGACTGGG No data
983266030_983266042 27 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266042 4:165509181-165509203 GGGGGATACCAGAACTCTGAGGG No data
983266030_983266037 7 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266037 4:165509161-165509183 AACCACATCGACTGGGGGCTGGG No data
983266030_983266032 -1 Left 983266030 4:165509131-165509153 CCAGGACTTGTTAGCACCTTATT No data
Right 983266032 4:165509153-165509175 TCGCTAGCAACCACATCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983266030 Original CRISPR AATAAGGTGCTAACAAGTCC TGG (reversed) Intergenic