ID: 983266031

View in Genome Browser
Species Human (GRCh38)
Location 4:165509147-165509169
Sequence GATGTGGTTGCTAGCGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983266031_983266042 11 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266042 4:165509181-165509203 GGGGGATACCAGAACTCTGAGGG No data
983266031_983266043 12 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266043 4:165509182-165509204 GGGGATACCAGAACTCTGAGGGG No data
983266031_983266046 27 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266046 4:165509197-165509219 CTGAGGGGACCTGGAATCAGAGG No data
983266031_983266044 18 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266044 4:165509188-165509210 ACCAGAACTCTGAGGGGACCTGG No data
983266031_983266040 -7 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266040 4:165509163-165509185 CCACATCGACTGGGGGCTGGGGG No data
983266031_983266037 -9 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266037 4:165509161-165509183 AACCACATCGACTGGGGGCTGGG No data
983266031_983266041 10 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266041 4:165509180-165509202 TGGGGGATACCAGAACTCTGAGG No data
983266031_983266036 -10 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266036 4:165509160-165509182 CAACCACATCGACTGGGGGCTGG No data
983266031_983266038 -8 Left 983266031 4:165509147-165509169 CCTTATTCGCTAGCAACCACATC No data
Right 983266038 4:165509162-165509184 ACCACATCGACTGGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983266031 Original CRISPR GATGTGGTTGCTAGCGAATA AGG (reversed) Intergenic
No off target data available for this crispr